ID: 1022781787

View in Genome Browser
Species Human (GRCh38)
Location 7:33592650-33592672
Sequence GTCCAGCTGGGTCACTGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022781787 Original CRISPR GTCCAGCTGGGTCACTGGCT TGG (reversed) Intronic
900874405 1:5331252-5331274 GTCCAGCTGGGGCAGAGGCCTGG + Intergenic
901653976 1:10758826-10758848 GTCCAGCCTGGTCACTGGAAAGG + Intronic
902395095 1:16128248-16128270 GCCCAGCAGGGCCACAGGCTTGG - Intronic
905404965 1:37726449-37726471 GCCCAGATGGGTCCCAGGCTGGG - Intronic
906528665 1:46511053-46511075 GTCCAGCTGGGTATCTGGAGTGG - Exonic
907752207 1:57273363-57273385 GCCCTGCTTTGTCACTGGCTGGG - Intronic
911143314 1:94528956-94528978 GTCAGGCTTGGTCACTTGCTTGG + Intergenic
915111460 1:153566723-153566745 GTGCCGCTGAGTCACTGCCTGGG - Intronic
917644788 1:177019152-177019174 GTCCAGCTAGGTCATTAACTAGG + Intronic
919676433 1:200388041-200388063 GTCCCGCTGTGTCACTAGGTTGG - Intergenic
922669035 1:227494952-227494974 GTGGAGCTGGGTGGCTGGCTAGG - Intergenic
922670562 1:227506350-227506372 GTGGAGCTGGGTGGCTGGCTAGG + Intergenic
1065967865 10:30783681-30783703 GTCCCTCTGGGTCTCAGGCTGGG + Intergenic
1066299150 10:34081575-34081597 GTCCAGAAGGGACAGTGGCTGGG - Intergenic
1066306636 10:34150655-34150677 CTCCAGCTGGGCCTCAGGCTTGG + Intronic
1068602210 10:58967987-58968009 GTACAGCTGGGTTATTGACTGGG + Intergenic
1069581564 10:69570243-69570265 TTCCACCTGGGTCACTGCCCGGG - Intergenic
1070328309 10:75401749-75401771 GTCCAGCCGGGGCTCTGGCGAGG + Exonic
1071956549 10:90767003-90767025 GTCAAGCAGGGCCACTGGCTGGG + Intronic
1073310200 10:102534862-102534884 GTCCAGCTGGGCCTAAGGCTGGG + Intronic
1073479097 10:103774915-103774937 GTCCAGCTGGGACACCGGAAGGG - Intronic
1075595924 10:123729026-123729048 GTTCAGCTGGCTGACTGGGTGGG - Intronic
1077487954 11:2847759-2847781 GTCCAGCTGCGTCACCTGCGGGG - Exonic
1077496275 11:2887991-2888013 CTCCAGGTGTGTCCCTGGCTTGG - Exonic
1078105341 11:8354821-8354843 GGCCAGGTGGGTTGCTGGCTGGG + Intergenic
1079295459 11:19229546-19229568 CTCCAGCTGGCTCCCTGGTTCGG + Exonic
1079529029 11:21426873-21426895 GTCCATCTGGAGCACTGGCATGG + Intronic
1079553421 11:21729840-21729862 CACCTGCTGGGTCACTGGGTGGG + Intergenic
1080370914 11:31641727-31641749 GTCCAGATGGGAGACTGGCTGGG - Intronic
1081975674 11:47233134-47233156 GTCCAGGTGGGTTACTGCTTTGG + Intronic
1083154404 11:60814272-60814294 GTCCAGCTGCATCAGTGGCTGGG + Intergenic
1083399490 11:62413941-62413963 TTCCAGCTGGGGCAGTGGCTGGG - Intronic
1083755676 11:64790422-64790444 GTCCACCTGGATCACCTGCTGGG + Exonic
1084045179 11:66564096-66564118 GAACAGCTGGGGCACTGACTGGG - Exonic
1084434972 11:69134035-69134057 GTCCACCTGGGCAGCTGGCTTGG + Intergenic
1084554470 11:69867766-69867788 ATCCAGCTGAGTCCCTGGCCTGG - Intergenic
1088609159 11:111560637-111560659 GTCGAGCTGGATGACTGGCTGGG - Exonic
1088766846 11:112990250-112990272 TTCCCACTGGGTCACTGGTTGGG + Intronic
1088885317 11:114001455-114001477 GTCCTGCTCAGTCACTGGCTAGG - Intergenic
1090602738 11:128389765-128389787 GGCCTTCTGGGTCACTGCCTTGG - Intergenic
1090806917 11:130208644-130208666 GGCCATCTGGGTCACGGGCTGGG + Exonic
1092432613 12:8421283-8421305 GGACAGCTGGTTCACAGGCTTGG - Intergenic
1092515891 12:9212059-9212081 CTCCTACTGGGTCACTGGGTAGG + Intergenic
1095488194 12:42706194-42706216 GTCCAGCTGGGGCAGGGCCTGGG - Intergenic
1097856759 12:64471769-64471791 GTCCTGATGTGTTACTGGCTTGG - Intronic
1099548454 12:84013503-84013525 TTGCAGCTTGGGCACTGGCTTGG - Intergenic
1102010703 12:109616735-109616757 GTCCTGCTGGGATACTGACTGGG - Intergenic
1103942383 12:124508136-124508158 GTCCAGCCTGGCCACTTGCTGGG - Intronic
1103981938 12:124742379-124742401 GTCCAGATGGGTGAGTCGCTGGG + Intergenic
1105899544 13:24743443-24743465 CCTCAGCTGGGTCACTGGTTTGG - Intergenic
1107531663 13:41288315-41288337 TTGCACCTGGGTCACTCGCTGGG + Intergenic
1113988761 13:114341494-114341516 GTCCTGCTCTGGCACTGGCTGGG - Intergenic
1114350655 14:21846939-21846961 GTCAAGCTGGGTCACCGACTGGG - Intergenic
1114351136 14:21852724-21852746 GTCAGGCTGGGTCACTGACTGGG - Intergenic
1114354725 14:21894748-21894770 GCCAAGCTGGGTCACCGACTGGG - Intergenic
1114355445 14:21903243-21903265 GTCAGGCTGGGTCACTGACTGGG - Intergenic
1114361523 14:21978838-21978860 GTCAAGCTGGGTCACAGACTGGG - Intergenic
1114374794 14:22132746-22132768 ATCAAGCTGGGTCACCGACTGGG - Intergenic
1116828057 14:49691188-49691210 TACCAGCTTGGTCACTGGGTGGG - Intergenic
1118854636 14:69611583-69611605 GTACAGCTGGGTCAGTGACGCGG + Exonic
1119682615 14:76604273-76604295 GTTCCGCTGGGTTACTGGGTGGG + Intergenic
1122289934 14:100675111-100675133 CTCCGGCTGGGACCCTGGCTGGG + Intergenic
1122406981 14:101506520-101506542 GCCCCTCTGGGTCACTGGCTTGG - Intergenic
1123114615 14:105889046-105889068 CTCCAGGTCGGTCACTGACTCGG + Intergenic
1124032391 15:26023369-26023391 GACCAGCTGAGTCACTGTCTTGG + Intergenic
1124630945 15:31336803-31336825 ATTCACCTGGGCCACTGGCTGGG + Intronic
1126697718 15:51340396-51340418 CTCCAGCTGGCTCATTGGCGGGG + Intergenic
1129019358 15:72502341-72502363 GCCCAGATGTGTCATTGGCTAGG + Intronic
1129393806 15:75233682-75233704 GTCCAGGTGGGGCCCTGCCTGGG + Intergenic
1129873218 15:78955016-78955038 CTTCAGCTGGGTCATGGGCTCGG + Intergenic
1129905809 15:79186452-79186474 GGCCAGCTGGGGCAATCGCTGGG - Intergenic
1132351108 15:101140361-101140383 CTCCAGGTGGGACACTGGCTTGG - Intergenic
1132702793 16:1229209-1229231 GCCGTGCTGGGTCACTGGCTGGG - Exonic
1132705533 16:1241659-1241681 GCCGTGCTGGGTCACTGGCTGGG + Exonic
1132708661 16:1257022-1257044 GCCGTGCTGGGTCACTGGCTGGG + Exonic
1132715516 16:1288265-1288287 GACCTGCTGGGTGACCGGCTGGG - Intergenic
1132934057 16:2472190-2472212 GGCCAGCTGGGCCATTGGCAGGG - Exonic
1132976577 16:2714083-2714105 GAACTGCTGGGTCACTGGCTGGG - Exonic
1133864246 16:9626932-9626954 ACTCAGCTTGGTCACTGGCTAGG + Intergenic
1134016474 16:10891924-10891946 TCCAAGCTGGGGCACTGGCTGGG - Intronic
1135065349 16:19304998-19305020 GACATGCTGAGTCACTGGCTAGG + Intronic
1135473792 16:22755616-22755638 GCCTAGCTGGGTGACTGGGTAGG + Intergenic
1135504632 16:23025797-23025819 GTGCACCAGGGTCACTTGCTGGG + Intergenic
1136399411 16:30009701-30009723 GTGCGTCTGGGTCCCTGGCTCGG + Intronic
1136555623 16:31006254-31006276 GTCCATCTGTCTCCCTGGCTGGG + Intronic
1136569175 16:31086651-31086673 CTCCTGCTGGGCCACTGGCTGGG - Exonic
1136632372 16:31496505-31496527 GGGTTGCTGGGTCACTGGCTGGG - Intronic
1137590393 16:49689888-49689910 GCAGAGCTGGGTCACTGCCTGGG - Intronic
1137694027 16:50449185-50449207 GTTCGGCGGGGTCACCGGCTGGG - Intergenic
1139584641 16:67893828-67893850 GTCCAGCTGGGTTGCTTGCTTGG + Intronic
1141472627 16:84249837-84249859 GTGAGGCTGGGTCCCTGGCTGGG + Intergenic
1142510155 17:387684-387706 GTGCAGCTGGGTGGCTGGTTAGG - Intergenic
1143478398 17:7215838-7215860 GTCCGGGTGAGTCACAGGCTGGG - Intronic
1145304744 17:21667349-21667371 GTCCAGCTGGGTGTCTGGCCTGG + Intergenic
1147166877 17:38598214-38598236 GGCCAGCCTGGTCACTGGGTGGG + Intronic
1147191714 17:38741827-38741849 GTCCATCAGGGACACTGGCAGGG - Intronic
1148211833 17:45813320-45813342 CTCCTGCTGGGTCAGGGGCTTGG - Intronic
1148846930 17:50534864-50534886 GACCAGTTGGGGCACGGGCTGGG + Intronic
1150169350 17:62976355-62976377 GTCAACCTGAGGCACTGGCTGGG - Intergenic
1150461422 17:65356785-65356807 GTGCCCCTGGGTCCCTGGCTGGG - Intergenic
1152099167 17:78291127-78291149 GCCCAGCTGTGACACTGGCAGGG - Intergenic
1152445019 17:80337425-80337447 GTCCAGCTGGGGCGCTGGGTGGG + Intronic
1152677813 17:81650744-81650766 GTCCAGCAGGCTCCCGGGCTGGG + Exonic
1152878935 17:82804456-82804478 GCTCAGCTGGGTCCCTGGTTAGG + Intronic
1152988393 18:340254-340276 GTACGGGTGGCTCACTGGCTCGG + Intronic
1154191251 18:12232398-12232420 GTCCAGCTGGTGCAGGGGCTGGG - Intergenic
1156495401 18:37522378-37522400 CTCCAGCTGGGTCCTGGGCTGGG - Intronic
1157452494 18:47799266-47799288 GTCCAGCTGGGGTAGTGTCTGGG + Intergenic
1157559359 18:48635826-48635848 GCCATGCTGGGTGACTGGCTGGG - Intronic
1158634741 18:59146858-59146880 GACCAGCTGGATCACTGGGAGGG - Intronic
1158931650 18:62329255-62329277 GTCCAGGTGGTTCACTCCCTAGG + Intronic
1160135212 18:76265933-76265955 CTGAAGCTGGGCCACTGGCTGGG + Intergenic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1165913885 19:39246452-39246474 GGCCACCTGAGTCCCTGGCTCGG + Intergenic
1165916981 19:39266476-39266498 GGCCACCTGAGTCCCTGGCTCGG - Intergenic
1166253949 19:41589320-41589342 GCCCAGCAGGGACACTGGATAGG - Intronic
1167950146 19:53019830-53019852 ATGCAGCTGGGTCAGGGGCTGGG - Intergenic
1168619664 19:57868032-57868054 GCCCAGCAGGGGCACTGCCTGGG + Intronic
925354638 2:3230105-3230127 GTACAGGTGTTTCACTGGCTTGG + Intronic
925374925 2:3377631-3377653 TTCCAGGTGGGTCACTGGGAGGG - Exonic
926750896 2:16197688-16197710 CTCCAGCAGGGTGACTGGCTGGG - Intergenic
928270073 2:29847993-29848015 GTCCAGCTGGCTCCCTAGCTGGG - Intronic
929511238 2:42568030-42568052 CCCCAGCTGGGTCTCTGGCGAGG + Intronic
929511640 2:42569220-42569242 GTCCAGCTGGGCCCCTGGCTGGG - Intronic
929721420 2:44372406-44372428 ACCCAGCTGGGTGACAGGCTGGG + Intronic
933960975 2:87407768-87407790 GTCTGGCTGGTTCGCTGGCTTGG - Intergenic
933961461 2:87409972-87409994 GTCTGGCTGGTTCGCTGGCTTGG - Intergenic
933962197 2:87413441-87413463 GTCTGGCTGGTTCGCTGGCTTGG - Intergenic
933963719 2:87420100-87420122 GTCTGGCTGGTTCGCTGGCTTGG - Intergenic
933965174 2:87426853-87426875 GTCTGGCTGGTTCGCTGGCTTGG - Intergenic
937858483 2:126690053-126690075 GTTCTGCTTGGTCACTGACTGGG - Intronic
937858984 2:126693663-126693685 GTTCTGCTTGGTCACTGACTGGG - Intronic
941176176 2:162199727-162199749 GTCCAGCAGTGTCTCTGGCCTGG - Intronic
947349731 2:229231071-229231093 CTTCAGCTGGGACACTGGCTGGG - Intronic
947474460 2:230430619-230430641 GTTCAGAAGTGTCACTGGCTGGG + Intronic
1168985380 20:2043835-2043857 GTCCCGCTGGGGCAGTAGCTTGG + Intergenic
1171522254 20:25784789-25784811 GTCCAGCTGGGTGTCTGGCCTGG + Intronic
1171530003 20:25846734-25846756 GTCCAGCTGGGTGTCTGGCCTGG + Intronic
1171554573 20:26071094-26071116 GTCCAGCTGGGTGTCTGGCCTGG - Intergenic
1172021274 20:31916032-31916054 TCCTAGCTGGCTCACTGGCTGGG + Intronic
1173841400 20:46159539-46159561 GTCCAGCTGGGGCACAGGGAGGG + Intergenic
1175255890 20:57646995-57647017 GGCCTTCTGTGTCACTGGCTTGG - Intergenic
1175644486 20:60659187-60659209 GTCCAGCAGGGTCTCCGGTTTGG - Intergenic
1175778164 20:61665980-61666002 GTCCAGGTGGGAGAATGGCTGGG + Intronic
1176656061 21:9589788-9589810 GTCCAGCTGGGTGTCTGGCCTGG + Intergenic
1180671923 22:17560422-17560444 GTCCAGCTGCATCAGTGGCTGGG + Intergenic
1181325969 22:22046312-22046334 GACCAGTTGGATCACTGGGTAGG - Intergenic
1181668189 22:24412718-24412740 GTCCCCCTGAGTCACTGGCAGGG + Intronic
1183000233 22:34850842-34850864 GTCCACCTGGAGCACAGGCTGGG + Intergenic
1183206969 22:36426344-36426366 GGCCAGCTGGGTCCCTGTGTGGG - Intergenic
1183330770 22:37219893-37219915 GCTCAGCTGGGTCGCTGGCATGG + Intergenic
1183524104 22:38313792-38313814 GGTCAGCTGGGTCACCAGCTGGG - Intronic
950408039 3:12816730-12816752 GGCCACCTGGGTGACCGGCTTGG + Exonic
950568014 3:13782715-13782737 GTCCGGTTGGCTCACTGCCTCGG + Intergenic
950812823 3:15665910-15665932 TTCAAGCTGGGTCTCTGGCTGGG - Intergenic
952776508 3:37051776-37051798 GCCCAGGTGGGGCACAGGCTGGG + Intergenic
956458150 3:69444017-69444039 GTCCAGCTGAGTCCCTGGTATGG - Intronic
956728264 3:72174556-72174578 GATCAGATGGGTCACTGTCTGGG - Intergenic
959926909 3:111932327-111932349 GTCCAGCTGGGTCTTCTGCTCGG - Exonic
960567296 3:119147125-119147147 GTTCAGCTAGTTCAGTGGCTTGG - Exonic
961272036 3:125696663-125696685 GGACAGCTGGTTCACTTGCTTGG + Intergenic
961447235 3:126986590-126986612 GTCTTCCTGGGTCCCTGGCTTGG + Intergenic
968075705 3:195815157-195815179 TTCATGCTGGGTCACTGACTAGG - Intergenic
969051691 4:4377841-4377863 GTGCAGCTGGGTCTGGGGCTTGG - Intronic
969526103 4:7704882-7704904 GCCCAGCTGATTCACAGGCTGGG + Intronic
976152234 4:82104141-82104163 GTCCAACTGAGTCACTGACCTGG + Intergenic
981463714 4:145040649-145040671 GGCTAGCTAGGTCACTAGCTAGG - Intronic
982027077 4:151261500-151261522 CTCCTGCTGGGTGACTGGATGGG + Intronic
982417815 4:155157527-155157549 CTCCCACTGGGTCACTGGCTAGG + Intergenic
984459471 4:180015242-180015264 GCCCTTCTGGGTGACTGGCTGGG + Intergenic
985537096 5:471607-471629 GTCCAGTAGGGTCACTGACTGGG + Exonic
988491945 5:31712419-31712441 GTTCAGCTGGGGCACTGGGATGG + Intronic
990462974 5:56046888-56046910 TTGCAGCTGGGTCTCAGGCTTGG - Intergenic
995405405 5:111789022-111789044 CTCCAAGTGGGACACTGGCTGGG + Intronic
997261621 5:132469668-132469690 GTCCAGCAGAGTCACTGTCCTGG - Intronic
997904330 5:137800123-137800145 ATCCTGCTGGGTCACTGGCTGGG - Intergenic
999368143 5:151036177-151036199 GATCAGCTGAGACACTGGCTAGG + Intronic
1001783057 5:174387077-174387099 CTCCAGCAGGGACACTGACTGGG + Intergenic
1002687113 5:181021386-181021408 GTCCAGCGAGACCACTGGCTAGG - Intergenic
1007729007 6:43934553-43934575 GTCCTTCTGGCTCACAGGCTGGG + Intergenic
1011802351 6:91031445-91031467 GTTTAACTGGGTCTCTGGCTGGG - Intergenic
1013304925 6:108838954-108838976 GTCCATCTGGGTCACGGAGTGGG - Intergenic
1014834541 6:126146099-126146121 TTCAAACTGAGTCACTGGCTTGG - Intergenic
1019262536 7:89569-89591 CTCCAGCTGGGCCACTGCCCAGG + Intergenic
1020978804 7:15042082-15042104 ACCCTGCTGGGTCACAGGCTTGG - Intergenic
1022781787 7:33592650-33592672 GTCCAGCTGGGTCACTGGCTTGG - Intronic
1022809177 7:33852069-33852091 GTGGTGCTGGGTGACTGGCTGGG + Intergenic
1023037862 7:36148668-36148690 ATCCAGCTGGGGGACAGGCTGGG + Intergenic
1023096831 7:36669960-36669982 ACCCAGCTGTGTCACTGGCTGGG + Intronic
1024081477 7:45859566-45859588 GCTCAGCTGGGTCTCTGCCTGGG - Intergenic
1025000097 7:55308784-55308806 TTCCACCTGGCTCTCTGGCTTGG + Intergenic
1025252790 7:57363070-57363092 GTCAGGCTGGGTTGCTGGCTGGG + Intergenic
1025282748 7:57639964-57639986 GTCCAGCTGGGTGTCTGGCCTGG + Intergenic
1025301969 7:57825453-57825475 GTCCAGCTGGGTGTCTGGCCTGG - Intergenic
1026023357 7:66727524-66727546 GTCCACCCAGGTCACTGGCTTGG - Intronic
1026650988 7:72215836-72215858 GGCCAGCCCAGTCACTGGCTGGG - Intronic
1026888156 7:73966716-73966738 GTCCACCCAGGACACTGGCTTGG - Intergenic
1029202398 7:98847853-98847875 GTACAGATGGGTGAATGGCTGGG + Exonic
1030982320 7:116200794-116200816 GCCCAGCTGGGGCACTTCCTTGG + Intergenic
1031025212 7:116672296-116672318 GCCCGGCTGAGTCACTGGCAGGG + Intergenic
1032327108 7:130939848-130939870 GACCTTCTGGGTCACTGACTAGG + Intergenic
1034259858 7:149748257-149748279 GCCCGGCATGGTCACTGGCTGGG + Intergenic
1035653026 8:1282794-1282816 GTCCAGATGGTTCACGTGCTGGG - Intergenic
1035653070 8:1283025-1283047 GTCCAGATGGTTCACGTGCTGGG - Intergenic
1035653090 8:1283140-1283162 GTCCAGATGGTTCACGTGCTGGG - Intergenic
1035715145 8:1748382-1748404 GTGCAGCTGTGTCACTGGGATGG - Intergenic
1037787305 8:21910715-21910737 GTACAGCTGGGTCCCTGGCTCGG + Exonic
1038493642 8:27987005-27987027 GGCCTTCTGGGTCACTGGCCTGG + Intronic
1038681805 8:29675592-29675614 GACCAGCAGAGTCACAGGCTTGG - Intergenic
1039309582 8:36301772-36301794 GACCAGCAGGGTCACATGCTTGG + Intergenic
1039916245 8:41862422-41862444 GTCCACCTGGGGCGCAGGCTGGG - Intronic
1040345281 8:46486438-46486460 GGCCAGCTGTCTCACTTGCTTGG + Intergenic
1041138624 8:54789372-54789394 GTCAGGCAGGGTCATTGGCTTGG - Intergenic
1044743721 8:95352549-95352571 GTCCTGCTCAGTCATTGGCTGGG - Intergenic
1047428376 8:124767321-124767343 GTCCTGCTGGGTCCCTGGAAGGG + Intergenic
1047436889 8:124842349-124842371 GACCAGCTGGCTCACTCACTGGG - Intergenic
1047934998 8:129767644-129767666 TTTGTGCTGGGTCACTGGCTGGG - Intronic
1047935078 8:129768075-129768097 GTCGGGCTGGATCACTGGCTGGG - Intronic
1049298418 8:141855992-141856014 CCCAAGCTGGGCCACTGGCTGGG + Intergenic
1049313671 8:141947429-141947451 TGCCCACTGGGTCACTGGCTTGG + Intergenic
1049843398 8:144788166-144788188 GCCCTGCTGGGTCACTGCCTAGG + Intergenic
1050013179 9:1206144-1206166 TTCCAGCTGTGCCACTGACTAGG + Intergenic
1050086104 9:1967460-1967482 GCCCAGCTGGGGCTCTGGCTTGG - Intergenic
1050730762 9:8706892-8706914 GTCCAGCGGGGACAGTGGCACGG - Intronic
1051748819 9:20320476-20320498 GTCCTGCTGGACCACTAGCTTGG - Intergenic
1052772837 9:32705268-32705290 CTGCAGGTGAGTCACTGGCTGGG - Intergenic
1053417674 9:37956787-37956809 GCCCAGCTGGATAACTGGCAAGG - Intronic
1056827625 9:89887742-89887764 TCCAGGCTGGGTCACTGGCTGGG - Intergenic
1057201015 9:93140030-93140052 GCCCAGCTGGCTCCCTGGATGGG - Intergenic
1059635359 9:116164998-116165020 ACCCAGCTTGGTCACTGACTTGG - Intronic
1062353364 9:136149903-136149925 GGCCAGCAGGGTCACAGGCCTGG - Intergenic
1203633778 Un_KI270750v1:93248-93270 GTCCAGCTGGGTGTCTGGCCTGG + Intergenic
1187258213 X:17660559-17660581 GTTCAGCTGGGTCACTGGGCTGG + Intronic
1190126370 X:47709069-47709091 CTCCTGCTGGGTTACTGGGTAGG + Intergenic
1190217183 X:48487777-48487799 GTCCAGCAGTGGCAATGGCTTGG + Intergenic
1192786849 X:74344547-74344569 GCCCACCTGGGTCCCTCGCTAGG + Intergenic
1200182080 X:154156693-154156715 GGCCAGCTGGAGCTCTGGCTGGG - Intronic