ID: 1022783709

View in Genome Browser
Species Human (GRCh38)
Location 7:33613772-33613794
Sequence GTGACCTGGGCAAGAAGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022783705_1022783709 -3 Left 1022783705 7:33613752-33613774 CCCAGCAATGACAAAAATAGGTG No data
Right 1022783709 7:33613772-33613794 GTGACCTGGGCAAGAAGCCAAGG No data
1022783706_1022783709 -4 Left 1022783706 7:33613753-33613775 CCAGCAATGACAAAAATAGGTGA No data
Right 1022783709 7:33613772-33613794 GTGACCTGGGCAAGAAGCCAAGG No data
1022783703_1022783709 8 Left 1022783703 7:33613741-33613763 CCTTAAAGTGACCCAGCAATGAC No data
Right 1022783709 7:33613772-33613794 GTGACCTGGGCAAGAAGCCAAGG No data
1022783702_1022783709 9 Left 1022783702 7:33613740-33613762 CCCTTAAAGTGACCCAGCAATGA No data
Right 1022783709 7:33613772-33613794 GTGACCTGGGCAAGAAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022783709 Original CRISPR GTGACCTGGGCAAGAAGCCA AGG Intergenic
No off target data available for this crispr