ID: 1022785149

View in Genome Browser
Species Human (GRCh38)
Location 7:33631227-33631249
Sequence GGCTGAGGGTCTCCCTGGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022785149_1022785154 -6 Left 1022785149 7:33631227-33631249 CCGTTCCAGGGAGACCCTCAGCC No data
Right 1022785154 7:33631244-33631266 TCAGCCCATGCCGGCCCTGCAGG No data
1022785149_1022785158 4 Left 1022785149 7:33631227-33631249 CCGTTCCAGGGAGACCCTCAGCC No data
Right 1022785158 7:33631254-33631276 CCGGCCCTGCAGGCGACTTAAGG No data
1022785149_1022785160 8 Left 1022785149 7:33631227-33631249 CCGTTCCAGGGAGACCCTCAGCC No data
Right 1022785160 7:33631258-33631280 CCCTGCAGGCGACTTAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022785149 Original CRISPR GGCTGAGGGTCTCCCTGGAA CGG (reversed) Intergenic
No off target data available for this crispr