ID: 1022788165

View in Genome Browser
Species Human (GRCh38)
Location 7:33659905-33659927
Sequence CTGTATAAGATGAAGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022788165_1022788170 28 Left 1022788165 7:33659905-33659927 CCTTGCACCTTCATCTTATACAG No data
Right 1022788170 7:33659956-33659978 TCCTGGAAAAACTTCCTACCAGG No data
1022788165_1022788169 11 Left 1022788165 7:33659905-33659927 CCTTGCACCTTCATCTTATACAG No data
Right 1022788169 7:33659939-33659961 GAGAGCTGTGGAAGTTTTCCTGG No data
1022788165_1022788168 -1 Left 1022788165 7:33659905-33659927 CCTTGCACCTTCATCTTATACAG No data
Right 1022788168 7:33659927-33659949 GGTGAATCAATAGAGAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022788165 Original CRISPR CTGTATAAGATGAAGGTGCA AGG (reversed) Intergenic
No off target data available for this crispr