ID: 1022790584

View in Genome Browser
Species Human (GRCh38)
Location 7:33684933-33684955
Sequence CACTCTTCACAGAAGGATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022790584_1022790589 9 Left 1022790584 7:33684933-33684955 CCTAGATCCTTCTGTGAAGAGTG No data
Right 1022790589 7:33684965-33684987 GCTGGAGAGTCAAGAATTCATGG No data
1022790584_1022790588 -9 Left 1022790584 7:33684933-33684955 CCTAGATCCTTCTGTGAAGAGTG No data
Right 1022790588 7:33684947-33684969 TGAAGAGTGGGAATTCTAGCTGG No data
1022790584_1022790590 10 Left 1022790584 7:33684933-33684955 CCTAGATCCTTCTGTGAAGAGTG No data
Right 1022790590 7:33684966-33684988 CTGGAGAGTCAAGAATTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022790584 Original CRISPR CACTCTTCACAGAAGGATCT AGG (reversed) Intergenic
No off target data available for this crispr