ID: 1022790857

View in Genome Browser
Species Human (GRCh38)
Location 7:33687706-33687728
Sequence CTATGGAGAGTTATTTTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022790857_1022790861 15 Left 1022790857 7:33687706-33687728 CCTTATAAAATAACTCTCCATAG No data
Right 1022790861 7:33687744-33687766 CCACCCAGTATGTTTAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022790857 Original CRISPR CTATGGAGAGTTATTTTATA AGG (reversed) Intergenic
No off target data available for this crispr