ID: 1022790858

View in Genome Browser
Species Human (GRCh38)
Location 7:33687723-33687745
Sequence GGGAATGCTACTTAACTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022790858_1022790861 -2 Left 1022790858 7:33687723-33687745 CCATAGAGTTAAGTAGCATTCCC No data
Right 1022790861 7:33687744-33687766 CCACCCAGTATGTTTAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022790858 Original CRISPR GGGAATGCTACTTAACTCTA TGG (reversed) Intergenic
No off target data available for this crispr