ID: 1022790861

View in Genome Browser
Species Human (GRCh38)
Location 7:33687744-33687766
Sequence CCACCCAGTATGTTTAACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022790857_1022790861 15 Left 1022790857 7:33687706-33687728 CCTTATAAAATAACTCTCCATAG No data
Right 1022790861 7:33687744-33687766 CCACCCAGTATGTTTAACAGAGG No data
1022790858_1022790861 -2 Left 1022790858 7:33687723-33687745 CCATAGAGTTAAGTAGCATTCCC No data
Right 1022790861 7:33687744-33687766 CCACCCAGTATGTTTAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022790861 Original CRISPR CCACCCAGTATGTTTAACAG AGG Intergenic
No off target data available for this crispr