ID: 1022791465

View in Genome Browser
Species Human (GRCh38)
Location 7:33693430-33693452
Sequence CAGTGGTACTAAAGGTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022791458_1022791465 28 Left 1022791458 7:33693379-33693401 CCCTGGACAGACAGAGTCTGGCT No data
Right 1022791465 7:33693430-33693452 CAGTGGTACTAAAGGTTAGGAGG No data
1022791459_1022791465 27 Left 1022791459 7:33693380-33693402 CCTGGACAGACAGAGTCTGGCTC No data
Right 1022791465 7:33693430-33693452 CAGTGGTACTAAAGGTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022791465 Original CRISPR CAGTGGTACTAAAGGTTAGG AGG Intergenic
No off target data available for this crispr