ID: 1022792094

View in Genome Browser
Species Human (GRCh38)
Location 7:33699391-33699413
Sequence AGAAAGCAATAGCCACAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022792094_1022792097 23 Left 1022792094 7:33699391-33699413 CCTTCTTGTGGCTATTGCTTTCT No data
Right 1022792097 7:33699437-33699459 ATTTTTCATTTAAGATATACGGG No data
1022792094_1022792096 22 Left 1022792094 7:33699391-33699413 CCTTCTTGTGGCTATTGCTTTCT No data
Right 1022792096 7:33699436-33699458 CATTTTTCATTTAAGATATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022792094 Original CRISPR AGAAAGCAATAGCCACAAGA AGG (reversed) Intergenic
No off target data available for this crispr