ID: 1022792096

View in Genome Browser
Species Human (GRCh38)
Location 7:33699436-33699458
Sequence CATTTTTCATTTAAGATATA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022792094_1022792096 22 Left 1022792094 7:33699391-33699413 CCTTCTTGTGGCTATTGCTTTCT No data
Right 1022792096 7:33699436-33699458 CATTTTTCATTTAAGATATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022792096 Original CRISPR CATTTTTCATTTAAGATATA CGG Intergenic
No off target data available for this crispr