ID: 1022793616

View in Genome Browser
Species Human (GRCh38)
Location 7:33714378-33714400
Sequence GGGCTGCAGCAGAAAGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022793616_1022793619 -8 Left 1022793616 7:33714378-33714400 CCAGGCTCTTTCTGCTGCAGCCC No data
Right 1022793619 7:33714393-33714415 TGCAGCCCTAGCACTGGGAGAGG No data
1022793616_1022793622 13 Left 1022793616 7:33714378-33714400 CCAGGCTCTTTCTGCTGCAGCCC No data
Right 1022793622 7:33714414-33714436 GGCTGCCATGTGAGCTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022793616 Original CRISPR GGGCTGCAGCAGAAAGAGCC TGG (reversed) Intergenic
No off target data available for this crispr