ID: 1022793619

View in Genome Browser
Species Human (GRCh38)
Location 7:33714393-33714415
Sequence TGCAGCCCTAGCACTGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022793614_1022793619 -6 Left 1022793614 7:33714376-33714398 CCCCAGGCTCTTTCTGCTGCAGC No data
Right 1022793619 7:33714393-33714415 TGCAGCCCTAGCACTGGGAGAGG No data
1022793608_1022793619 25 Left 1022793608 7:33714345-33714367 CCCTCAAGGTGGGTGCCTGAGTC No data
Right 1022793619 7:33714393-33714415 TGCAGCCCTAGCACTGGGAGAGG No data
1022793616_1022793619 -8 Left 1022793616 7:33714378-33714400 CCAGGCTCTTTCTGCTGCAGCCC No data
Right 1022793619 7:33714393-33714415 TGCAGCCCTAGCACTGGGAGAGG No data
1022793613_1022793619 -3 Left 1022793613 7:33714373-33714395 CCTCCCCAGGCTCTTTCTGCTGC No data
Right 1022793619 7:33714393-33714415 TGCAGCCCTAGCACTGGGAGAGG No data
1022793615_1022793619 -7 Left 1022793615 7:33714377-33714399 CCCAGGCTCTTTCTGCTGCAGCC No data
Right 1022793619 7:33714393-33714415 TGCAGCCCTAGCACTGGGAGAGG No data
1022793609_1022793619 24 Left 1022793609 7:33714346-33714368 CCTCAAGGTGGGTGCCTGAGTCC No data
Right 1022793619 7:33714393-33714415 TGCAGCCCTAGCACTGGGAGAGG No data
1022793610_1022793619 10 Left 1022793610 7:33714360-33714382 CCTGAGTCCATCTCCTCCCCAGG No data
Right 1022793619 7:33714393-33714415 TGCAGCCCTAGCACTGGGAGAGG No data
1022793612_1022793619 3 Left 1022793612 7:33714367-33714389 CCATCTCCTCCCCAGGCTCTTTC No data
Right 1022793619 7:33714393-33714415 TGCAGCCCTAGCACTGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022793619 Original CRISPR TGCAGCCCTAGCACTGGGAG AGG Intergenic
No off target data available for this crispr