ID: 1022793622

View in Genome Browser
Species Human (GRCh38)
Location 7:33714414-33714436
Sequence GGCTGCCATGTGAGCTGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022793612_1022793622 24 Left 1022793612 7:33714367-33714389 CCATCTCCTCCCCAGGCTCTTTC No data
Right 1022793622 7:33714414-33714436 GGCTGCCATGTGAGCTGCCATGG No data
1022793616_1022793622 13 Left 1022793616 7:33714378-33714400 CCAGGCTCTTTCTGCTGCAGCCC No data
Right 1022793622 7:33714414-33714436 GGCTGCCATGTGAGCTGCCATGG No data
1022793613_1022793622 18 Left 1022793613 7:33714373-33714395 CCTCCCCAGGCTCTTTCTGCTGC No data
Right 1022793622 7:33714414-33714436 GGCTGCCATGTGAGCTGCCATGG No data
1022793621_1022793622 -8 Left 1022793621 7:33714399-33714421 CCTAGCACTGGGAGAGGCTGCCA No data
Right 1022793622 7:33714414-33714436 GGCTGCCATGTGAGCTGCCATGG No data
1022793615_1022793622 14 Left 1022793615 7:33714377-33714399 CCCAGGCTCTTTCTGCTGCAGCC No data
Right 1022793622 7:33714414-33714436 GGCTGCCATGTGAGCTGCCATGG No data
1022793614_1022793622 15 Left 1022793614 7:33714376-33714398 CCCCAGGCTCTTTCTGCTGCAGC No data
Right 1022793622 7:33714414-33714436 GGCTGCCATGTGAGCTGCCATGG No data
1022793620_1022793622 -7 Left 1022793620 7:33714398-33714420 CCCTAGCACTGGGAGAGGCTGCC No data
Right 1022793622 7:33714414-33714436 GGCTGCCATGTGAGCTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022793622 Original CRISPR GGCTGCCATGTGAGCTGCCA TGG Intergenic
No off target data available for this crispr