ID: 1022794134

View in Genome Browser
Species Human (GRCh38)
Location 7:33718672-33718694
Sequence TACTCACTTCTCCCCAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022794131_1022794134 20 Left 1022794131 7:33718629-33718651 CCGAGAAATAACAAACTTTTTTT No data
Right 1022794134 7:33718672-33718694 TACTCACTTCTCCCCAGGACAGG No data
1022794130_1022794134 25 Left 1022794130 7:33718624-33718646 CCAAGCCGAGAAATAACAAACTT No data
Right 1022794134 7:33718672-33718694 TACTCACTTCTCCCCAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022794134 Original CRISPR TACTCACTTCTCCCCAGGAC AGG Intergenic
No off target data available for this crispr