ID: 1022796628

View in Genome Browser
Species Human (GRCh38)
Location 7:33736674-33736696
Sequence AGTCACCCGCTTCACAAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022796628_1022796633 7 Left 1022796628 7:33736674-33736696 CCTTACTTGTGAAGCGGGTGACT No data
Right 1022796633 7:33736704-33736726 GTACCATCTTGCTGACTAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022796628 Original CRISPR AGTCACCCGCTTCACAAGTA AGG (reversed) Intergenic
No off target data available for this crispr