ID: 1022801247

View in Genome Browser
Species Human (GRCh38)
Location 7:33779492-33779514
Sequence CAGTGTAGGGGGAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022801235_1022801247 4 Left 1022801235 7:33779465-33779487 CCCCACGAGGAAGAGCAGGGAAG No data
Right 1022801247 7:33779492-33779514 CAGTGTAGGGGGAAGGGGGAGGG No data
1022801234_1022801247 5 Left 1022801234 7:33779464-33779486 CCCCCACGAGGAAGAGCAGGGAA No data
Right 1022801247 7:33779492-33779514 CAGTGTAGGGGGAAGGGGGAGGG No data
1022801236_1022801247 3 Left 1022801236 7:33779466-33779488 CCCACGAGGAAGAGCAGGGAAGA No data
Right 1022801247 7:33779492-33779514 CAGTGTAGGGGGAAGGGGGAGGG No data
1022801237_1022801247 2 Left 1022801237 7:33779467-33779489 CCACGAGGAAGAGCAGGGAAGAG No data
Right 1022801247 7:33779492-33779514 CAGTGTAGGGGGAAGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022801247 Original CRISPR CAGTGTAGGGGGAAGGGGGA GGG Intergenic
No off target data available for this crispr