ID: 1022802308

View in Genome Browser
Species Human (GRCh38)
Location 7:33788198-33788220
Sequence CAGCCTTCATGGCTCTAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022802308_1022802311 0 Left 1022802308 7:33788198-33788220 CCCAATTAGAGCCATGAAGGCTG No data
Right 1022802311 7:33788221-33788243 TGACCCACCCACCACTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022802308 Original CRISPR CAGCCTTCATGGCTCTAATT GGG (reversed) Intergenic
No off target data available for this crispr