ID: 1022809194

View in Genome Browser
Species Human (GRCh38)
Location 7:33852175-33852197
Sequence AGCAATCTCTAGATTAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022809186_1022809194 21 Left 1022809186 7:33852131-33852153 CCAAGAGGTAGTAGAGTCACGGG No data
Right 1022809194 7:33852175-33852197 AGCAATCTCTAGATTAGGCTGGG No data
1022809191_1022809194 -10 Left 1022809191 7:33852162-33852184 CCAAGGCGCACACAGCAATCTCT No data
Right 1022809194 7:33852175-33852197 AGCAATCTCTAGATTAGGCTGGG No data
1022809184_1022809194 22 Left 1022809184 7:33852130-33852152 CCCAAGAGGTAGTAGAGTCACGG No data
Right 1022809194 7:33852175-33852197 AGCAATCTCTAGATTAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022809194 Original CRISPR AGCAATCTCTAGATTAGGCT GGG Intergenic