ID: 1022810652

View in Genome Browser
Species Human (GRCh38)
Location 7:33864658-33864680
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022810652_1022810663 23 Left 1022810652 7:33864658-33864680 CCATCCCCCTGTCTTTAAATATG No data
Right 1022810663 7:33864704-33864726 AGGTGCCCAGAAATATCCAGGGG No data
1022810652_1022810662 22 Left 1022810652 7:33864658-33864680 CCATCCCCCTGTCTTTAAATATG No data
Right 1022810662 7:33864703-33864725 AAGGTGCCCAGAAATATCCAGGG No data
1022810652_1022810661 21 Left 1022810652 7:33864658-33864680 CCATCCCCCTGTCTTTAAATATG No data
Right 1022810661 7:33864702-33864724 TAAGGTGCCCAGAAATATCCAGG No data
1022810652_1022810659 3 Left 1022810652 7:33864658-33864680 CCATCCCCCTGTCTTTAAATATG No data
Right 1022810659 7:33864684-33864706 CCAGCACTTCTCCAACTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022810652 Original CRISPR CATATTTAAAGACAGGGGGA TGG (reversed) Intergenic
No off target data available for this crispr