ID: 1022810656

View in Genome Browser
Species Human (GRCh38)
Location 7:33864664-33864686
Sequence TGGCACCATATTTAAAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022810656_1022810663 17 Left 1022810656 7:33864664-33864686 CCCTGTCTTTAAATATGGTGCCA No data
Right 1022810663 7:33864704-33864726 AGGTGCCCAGAAATATCCAGGGG No data
1022810656_1022810662 16 Left 1022810656 7:33864664-33864686 CCCTGTCTTTAAATATGGTGCCA No data
Right 1022810662 7:33864703-33864725 AAGGTGCCCAGAAATATCCAGGG No data
1022810656_1022810661 15 Left 1022810656 7:33864664-33864686 CCCTGTCTTTAAATATGGTGCCA No data
Right 1022810661 7:33864702-33864724 TAAGGTGCCCAGAAATATCCAGG No data
1022810656_1022810659 -3 Left 1022810656 7:33864664-33864686 CCCTGTCTTTAAATATGGTGCCA No data
Right 1022810659 7:33864684-33864706 CCAGCACTTCTCCAACTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022810656 Original CRISPR TGGCACCATATTTAAAGACA GGG (reversed) Intergenic
No off target data available for this crispr