ID: 1022810658

View in Genome Browser
Species Human (GRCh38)
Location 7:33864684-33864706
Sequence CCTTACAGTTGGAGAAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022810658_1022810662 -4 Left 1022810658 7:33864684-33864706 CCAGCACTTCTCCAACTGTAAGG No data
Right 1022810662 7:33864703-33864725 AAGGTGCCCAGAAATATCCAGGG No data
1022810658_1022810661 -5 Left 1022810658 7:33864684-33864706 CCAGCACTTCTCCAACTGTAAGG No data
Right 1022810661 7:33864702-33864724 TAAGGTGCCCAGAAATATCCAGG No data
1022810658_1022810663 -3 Left 1022810658 7:33864684-33864706 CCAGCACTTCTCCAACTGTAAGG No data
Right 1022810663 7:33864704-33864726 AGGTGCCCAGAAATATCCAGGGG No data
1022810658_1022810667 28 Left 1022810658 7:33864684-33864706 CCAGCACTTCTCCAACTGTAAGG No data
Right 1022810667 7:33864735-33864757 ACATGCACATTCTTATTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022810658 Original CRISPR CCTTACAGTTGGAGAAGTGC TGG (reversed) Intergenic
No off target data available for this crispr