ID: 1022810661

View in Genome Browser
Species Human (GRCh38)
Location 7:33864702-33864724
Sequence TAAGGTGCCCAGAAATATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022810655_1022810661 16 Left 1022810655 7:33864663-33864685 CCCCTGTCTTTAAATATGGTGCC No data
Right 1022810661 7:33864702-33864724 TAAGGTGCCCAGAAATATCCAGG No data
1022810657_1022810661 14 Left 1022810657 7:33864665-33864687 CCTGTCTTTAAATATGGTGCCAG No data
Right 1022810661 7:33864702-33864724 TAAGGTGCCCAGAAATATCCAGG No data
1022810658_1022810661 -5 Left 1022810658 7:33864684-33864706 CCAGCACTTCTCCAACTGTAAGG No data
Right 1022810661 7:33864702-33864724 TAAGGTGCCCAGAAATATCCAGG No data
1022810656_1022810661 15 Left 1022810656 7:33864664-33864686 CCCTGTCTTTAAATATGGTGCCA No data
Right 1022810661 7:33864702-33864724 TAAGGTGCCCAGAAATATCCAGG No data
1022810654_1022810661 17 Left 1022810654 7:33864662-33864684 CCCCCTGTCTTTAAATATGGTGC No data
Right 1022810661 7:33864702-33864724 TAAGGTGCCCAGAAATATCCAGG No data
1022810652_1022810661 21 Left 1022810652 7:33864658-33864680 CCATCCCCCTGTCTTTAAATATG No data
Right 1022810661 7:33864702-33864724 TAAGGTGCCCAGAAATATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022810661 Original CRISPR TAAGGTGCCCAGAAATATCC AGG Intergenic
No off target data available for this crispr