ID: 1022813552

View in Genome Browser
Species Human (GRCh38)
Location 7:33892492-33892514
Sequence ATCTCTGCTTAGATTATGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022813551_1022813552 -7 Left 1022813551 7:33892476-33892498 CCTTGAGGGGATTTAGATCTCTG No data
Right 1022813552 7:33892492-33892514 ATCTCTGCTTAGATTATGTATGG No data
1022813550_1022813552 4 Left 1022813550 7:33892465-33892487 CCTCTCAGTCTCCTTGAGGGGAT No data
Right 1022813552 7:33892492-33892514 ATCTCTGCTTAGATTATGTATGG No data
1022813547_1022813552 7 Left 1022813547 7:33892462-33892484 CCACCTCTCAGTCTCCTTGAGGG No data
Right 1022813552 7:33892492-33892514 ATCTCTGCTTAGATTATGTATGG No data
1022813545_1022813552 17 Left 1022813545 7:33892452-33892474 CCTCAGGTCTCCACCTCTCAGTC No data
Right 1022813552 7:33892492-33892514 ATCTCTGCTTAGATTATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022813552 Original CRISPR ATCTCTGCTTAGATTATGTA TGG Intergenic
No off target data available for this crispr