ID: 1022816095

View in Genome Browser
Species Human (GRCh38)
Location 7:33915867-33915889
Sequence TCTACCCTTTAATAGTTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022816095 Original CRISPR TCTACCCTTTAATAGTTGTA TGG Intronic
903443188 1:23403669-23403691 TATACCCTTTGCTAGTTGGATGG - Intronic
904012274 1:27396626-27396648 TCTACCATTTTTTAGCTGTATGG - Intergenic
905962059 1:42051323-42051345 TCTGCCATTTACTAATTGTATGG - Intergenic
907589238 1:55650237-55650259 GGTACCCTTTAAAAGTTGTAGGG - Intergenic
909221344 1:72965379-72965401 TATATCCATTAAGAGTTGTATGG - Intergenic
909657571 1:78047625-78047647 TCTACCCTTTACTAGCTGTGTGG + Intronic
910813923 1:91268444-91268466 TCTCTCATTTATTAGTTGTATGG + Intronic
911430500 1:97779855-97779877 TCTAACTTTTACTAGCTGTAGGG + Intronic
912310407 1:108615188-108615210 TCTGCCCTTTACTAGTTATCTGG + Intronic
912575816 1:110672340-110672362 TCTAGACTTTGATAGTTGTTGGG + Intergenic
913114838 1:115686621-115686643 TCTACCCTCTATTAGATATATGG + Intronic
914246608 1:145890944-145890966 TCTGCCATTTATTAGCTGTATGG - Intergenic
914442952 1:147723019-147723041 TCTGCCACTTATTAGTTGTATGG + Intergenic
915537043 1:156543004-156543026 TCTACCATTTACTAGCTGTGTGG - Intronic
915611753 1:156999289-156999311 TCTACTATTTAATAGCTGTATGG - Intronic
916418778 1:164616939-164616961 TCTACCATTTAACAGCTGTATGG - Intronic
919285051 1:195546740-195546762 TCTACTCTTTAAAGGTAGTATGG + Intergenic
919385032 1:196910880-196910902 TCTACCTTTTAATCATTTTATGG + Intronic
919413036 1:197270733-197270755 TCTACCATTCACTAGTAGTATGG - Intronic
920706791 1:208257192-208257214 TAGACCCTTTAAAAGTTATAAGG - Intergenic
921410211 1:214827998-214828020 TCTATCCTTTAGTACTTGCATGG + Intergenic
1063684878 10:8227536-8227558 TTTAGCCATTAATGGTTGTAAGG + Intergenic
1064920711 10:20514732-20514754 TCTACCATTTACTAGTTGTATGG + Intergenic
1065421402 10:25548617-25548639 TCTACTCTTTCTTAGTTGTGGGG - Intronic
1068124145 10:52817347-52817369 TCTTCCCATTAACAGTTCTATGG + Intergenic
1068326444 10:55494188-55494210 TCTACCCATTAATAAAAGTAGGG + Intronic
1069092017 10:64211193-64211215 TCTACCACTTATTAGTTGTAAGG - Intergenic
1069174442 10:65272604-65272626 TCTATTCTTAAATAGTTCTATGG + Intergenic
1069625584 10:69865891-69865913 TCTACCATTTACTAGCTGCATGG + Intronic
1070015306 10:72523179-72523201 CCTCTCCTTTAATAATTGTATGG - Intronic
1070163113 10:73877790-73877812 TCTTCCCTCTAATTGCTGTAGGG - Intergenic
1071753818 10:88512864-88512886 TTTCTCCTTTATTAGTTGTATGG + Intronic
1072218112 10:93305095-93305117 TCTACCATTTATTGGTTGTGTGG + Intergenic
1072423508 10:95309598-95309620 TCTACCATTTAATCATTGAAAGG + Intergenic
1073013376 10:100379092-100379114 TCTACTACTTAATAGATGTATGG + Intergenic
1074365467 10:112854367-112854389 TCTATCCCTTAATAATTGTGTGG - Intergenic
1075364115 10:121867827-121867849 TCTCCATTTTAATGGTTGTAGGG + Intronic
1075539894 10:123303475-123303497 TCTACCTTTTTATACTTGTCAGG + Intergenic
1078929093 11:15899637-15899659 TCTACCACTTAATAGCTGTGTGG + Intergenic
1079927627 11:26514514-26514536 TCTACCATTTACTAGCTCTATGG - Intronic
1080107222 11:28523714-28523736 TCCAACCTTTAAGAGTTTTATGG - Intergenic
1080180685 11:29421740-29421762 TGTACCCTTTGATATTTGTAAGG - Intergenic
1083049491 11:59764447-59764469 TCTACCATTTAATAGCTATATGG - Intronic
1085092304 11:73727554-73727576 TCTACCATTTAGTAGTTGGATGG - Intronic
1085146376 11:74201592-74201614 ACTACCATTTAGTAGTTGTGTGG + Intronic
1086629998 11:89006280-89006302 TCTACCCTGCCATAGTTGTGAGG + Intronic
1086754201 11:90538379-90538401 TCCACACTTTGACAGTTGTATGG + Intergenic
1090452415 11:126818402-126818424 TCTGCCATTTACTAGTTGTGTGG + Intronic
1091414259 12:267259-267281 TCTACCATTTACTAGTTATGTGG - Intergenic
1091631564 12:2164721-2164743 CCTACCACTTAATAGTTGTGTGG + Intronic
1092990912 12:13898393-13898415 TCTGCCATTTATTAGTTGTGTGG - Intronic
1095331691 12:40973199-40973221 TCTACCATTTAATAGGAATATGG - Intronic
1097390898 12:59011551-59011573 TCTACCCTTTATTAGCTATGTGG - Intergenic
1099931163 12:89076631-89076653 TCTACCCAGCAAGAGTTGTATGG - Intergenic
1100151758 12:91746507-91746529 TCTACTCTTTCATAATTGTGTGG - Intergenic
1102731898 12:115118948-115118970 ACTTTCCTTTAAGAGTTGTATGG + Intergenic
1104159595 12:126165530-126165552 TCTACCACTTACTAGTTGTGTGG - Intergenic
1107120607 13:36791383-36791405 TCTACCATTTAATAGTTTCCTGG - Intergenic
1108091311 13:46852946-46852968 TCTGTCCTATAATAGTTCTAGGG + Intronic
1108908447 13:55509664-55509686 TCTACACTTTAATTTTTGTGAGG + Intergenic
1109630075 13:65034208-65034230 TCTACCCTTAAACAGTAGCATGG + Intergenic
1109912756 13:68937116-68937138 TATTTCCTTTAATAGTTTTAGGG + Intergenic
1110960336 13:81614238-81614260 TTTTGCCTTTAATAGTTGTCTGG - Intergenic
1113114714 13:106863050-106863072 TCAGCCCCTTAATAGTTGTATGG + Intergenic
1115040312 14:28916505-28916527 TCTGCCATTTACTAGTTGTTTGG + Intergenic
1115227898 14:31124103-31124125 GTTACCCTTTAACACTTGTAAGG + Intronic
1117158250 14:52961927-52961949 TGTATCTTTTAATAGGTGTAGGG - Intergenic
1118427255 14:65679409-65679431 TCTACATTTTAAAAGTTATATGG + Intronic
1120351739 14:83369657-83369679 CCCACCCTTTAATAGTACTATGG + Intergenic
1121746702 14:96301300-96301322 TGTAGCTTTTACTAGTTGTATGG - Intronic
1122015360 14:98790455-98790477 TCTACTCTTTGATAGCTGTGTGG - Intergenic
1125153403 15:36559882-36559904 TCTACCATTTAAAAGCTATATGG - Intergenic
1126644385 15:50860265-50860287 TCTACCCTTTATTAGCAGTGAGG - Intergenic
1127102392 15:55580630-55580652 TCTGCCATTTATTAGCTGTATGG - Intronic
1133529321 16:6640074-6640096 TCTACCACTTAATATTTATATGG - Intronic
1134345905 16:13391651-13391673 TCCACCCTTTAATTGATCTAGGG - Intergenic
1134470085 16:14516947-14516969 AATACCCTTTATTAGCTGTAAGG - Intronic
1135834997 16:25817108-25817130 TCTTCCCTTTACTAGCTGCATGG + Intronic
1139337030 16:66239966-66239988 TCTACCCTTGACCAGTTGTATGG + Intergenic
1140433278 16:74923242-74923264 TCTATCATTTAATACTGGTATGG - Intronic
1140987757 16:80175136-80175158 TCTTCCCTTGAATATTTGAAGGG + Intergenic
1142628962 17:1211658-1211680 TCTACCCCTTACTAGCTGTGAGG - Intronic
1146749716 17:35367766-35367788 TCTGCCATTTATTAGCTGTACGG + Intronic
1148722104 17:49761564-49761586 TCTGCCATTTACTAGTTGTGTGG - Intronic
1149102285 17:52921437-52921459 TTTACCCTTTAATTGTTTTGGGG - Intergenic
1149488043 17:57059749-57059771 TCCACCCTTTCATAGTTGATGGG + Intergenic
1152988515 18:341258-341280 TCTGCCATTTACTAGTTGTTTGG + Intronic
1153725100 18:7946197-7946219 TATAGCCTTGAATAGTTGTGAGG + Intronic
1154968195 18:21380597-21380619 TCTATCCCTTAATAGTTGAATGG + Intronic
1155830273 18:30508236-30508258 TATACCCTTACATAGTGGTAAGG - Intergenic
1157135493 18:45050319-45050341 TTTACTCTTTACTAGTTGTGGGG - Intronic
1164756363 19:30692723-30692745 TCTCCCCTTTAAATCTTGTAAGG - Intronic
1165722310 19:38088237-38088259 TCTGCCCCTTAATAGATGTCTGG - Intronic
1168065300 19:53915839-53915861 TCTACCTCTCACTAGTTGTATGG - Intronic
926183505 2:10667996-10668018 TCCACCCTTGACTAGTTGTGTGG + Intronic
930213095 2:48663519-48663541 TTTACACTTTAATACTTCTAGGG - Intronic
930499462 2:52194059-52194081 TTTATTCTTTAATAGTTGTCAGG - Intergenic
931079785 2:58755629-58755651 TCTGCCATTTATTAGCTGTATGG + Intergenic
931128063 2:59299459-59299481 TCTACCATGTTATAGTTGTGAGG + Intergenic
931511718 2:63004190-63004212 TCCACCATTTAATAATTGGATGG - Intronic
931854061 2:66283002-66283024 TCTGCCTTGTAATAGCTGTAAGG - Intergenic
934682236 2:96292654-96292676 CCAACTCTCTAATAGTTGTAGGG + Intronic
935838170 2:107077896-107077918 TCTCCACTTTAATAACTGTAAGG - Intergenic
941492642 2:166161901-166161923 TCTACCAATTAATAGTATTATGG + Intergenic
1181611705 22:24018421-24018443 TATCTCCTTTAGTAGTTGTATGG + Intronic
1181849645 22:25740981-25741003 TCTACCCTTTGCTAGCTGCATGG + Intergenic
949746776 3:7304008-7304030 TCTACCCTTAATTAGTAGTTAGG + Intronic
950055860 3:10023927-10023949 TTTACCTTTTAATTGTGGTATGG - Intergenic
950382649 3:12630238-12630260 TCCACCTTTTATTAGCTGTATGG + Intronic
951926212 3:27911406-27911428 TCCACCATTTAGTAGTTGTATGG + Intergenic
952383954 3:32825621-32825643 TTTAACCTTTATTAGTTTTATGG - Intronic
957204460 3:77177576-77177598 TATTACCTTTAATTGTTGTATGG + Intronic
959814397 3:110658349-110658371 TCTACCCTCTAAAATCTGTAGGG + Intergenic
960190186 3:114694945-114694967 CTTACCCTTTATTACTTGTATGG + Intronic
960675905 3:120194615-120194637 TCTACCTTCAAAGAGTTGTAAGG + Intronic
963697138 3:148575998-148576020 TCTTCCCTTTCCTAGTTCTAAGG - Intergenic
965166482 3:165198883-165198905 TCTGGCCTGTAATATTTGTATGG - Intergenic
965350414 3:167605150-167605172 TCTTGCCTTTAATAATTGTTTGG - Intronic
966649959 3:182289374-182289396 TCTGCTACTTAATAGTTGTATGG - Intergenic
967046343 3:185740717-185740739 TCTAACCTTTACTAGGTATATGG - Intronic
970602029 4:17648084-17648106 TCCACCATTTAATAGCTGTGTGG - Intronic
971350386 4:25850734-25850756 TCCTCCTTTTAATAGCTGTATGG - Intronic
971384370 4:26129602-26129624 TCTATAATTTAAGAGTTGTAAGG - Intergenic
972117787 4:35659214-35659236 TTTCCTCTTTAATAGTAGTAAGG - Intergenic
975129164 4:70815182-70815204 TCTCCCCTTTTATAGTTTCAAGG - Intergenic
975931693 4:79532023-79532045 TCTACCCTTTAATAACTTCAGGG + Intergenic
976427230 4:84919453-84919475 TAGACCCTTTATTAGTTGCAAGG + Intronic
976513527 4:85937573-85937595 TACACTCTTTAATAGTTGTCTGG - Intronic
977465337 4:97377310-97377332 TCTACCATTTACTAGCTGTGTGG + Intronic
977656635 4:99529327-99529349 TCTTCCCTTTATCAGTTGGAAGG - Intronic
977981959 4:103334598-103334620 TTTACCTGTTGATAGTTGTATGG - Intergenic
979219472 4:118205706-118205728 TCAACTCTTTACTAGTTATATGG + Intronic
980486092 4:133459609-133459631 TTTCCCCTTCCATAGTTGTAGGG - Intergenic
981357858 4:143812026-143812048 TCTAACCTTTAAGATTTGTCAGG - Intergenic
981507177 4:145514983-145515005 TCTACTCTCTTATAGTGGTAGGG - Exonic
982113673 4:152079031-152079053 TCCACCCTTGAATGGTTGCAAGG - Intergenic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
984814010 4:183820470-183820492 TCTACTCTTTAAAAGCTGCAGGG + Intergenic
989413199 5:41143660-41143682 TCTACCATTTACTAATTGTGTGG - Intronic
989458301 5:41667516-41667538 TCTACCTTATAATAGTTGTAGGG + Intergenic
990960497 5:61388656-61388678 TCTGCCATTTATTAGTTGTGTGG - Intronic
991563227 5:67977070-67977092 TATATCCTTAAATAGTTCTAAGG + Intergenic
994181214 5:96768383-96768405 TCTACAGTTTAAAAATTGTAAGG - Intronic
994563139 5:101403260-101403282 TCAACGTTTTAATAGCTGTATGG - Intergenic
999301816 5:150495857-150495879 TCTATCCTTTTATAGCTGTGTGG - Intronic
1003768069 6:9263285-9263307 TTAACCCTTTATTAGATGTATGG - Intergenic
1004655368 6:17654881-17654903 TCTGCCACTTAATAGCTGTATGG - Intronic
1005053084 6:21703149-21703171 TTTCCCTTTTAAAAGTTGTATGG + Intergenic
1005930978 6:30483746-30483768 TCGACCCTTTAAAAGCTGTTTGG + Intergenic
1007288232 6:40763528-40763550 TCTGCCATTTACTAATTGTATGG + Intergenic
1012331950 6:98002440-98002462 TCTACCTAGTAACAGTTGTAGGG - Intergenic
1012463136 6:99486451-99486473 ACTTCCCTTTAGTAGTTTTAAGG + Intronic
1012610983 6:101219969-101219991 TTTACACTTTTATACTTGTATGG - Intergenic
1012764211 6:103344335-103344357 TGTAACCTTTAATAGCAGTATGG + Intergenic
1013050624 6:106531358-106531380 GCTATCCTTGAATAGTTGGAAGG + Intronic
1013146431 6:107398733-107398755 ATGACCTTTTAATAGTTGTATGG - Intronic
1015140858 6:129930010-129930032 TATACCCTTCAATACTGGTATGG + Intergenic
1015370604 6:132447673-132447695 TTTTCACTTTAATATTTGTAAGG + Exonic
1016231706 6:141813951-141813973 TCTACTGTTTATTAGTTTTATGG - Intergenic
1016488406 6:144568874-144568896 TCCACCATTTACTAGCTGTATGG - Intronic
1017418267 6:154244904-154244926 TTTACCTTTTAATAGTGGTCAGG - Intronic
1020570478 7:9854261-9854283 TCTGCCATATAATAGTTGTATGG + Intergenic
1021743170 7:23709284-23709306 TCTACCTTTTAATAGGTGTTTGG - Intergenic
1021749695 7:23783810-23783832 ATGACCCTTTAATAGTTGCATGG + Intronic
1021823700 7:24525089-24525111 TCAATTCTTTAATAGTTATAGGG - Intergenic
1021930203 7:25573160-25573182 TCTACTCTTTGATAGTAATATGG + Intergenic
1022280775 7:28907011-28907033 TCAAGCCTTTAACAGATGTATGG - Intergenic
1022816095 7:33915867-33915889 TCTACCCTTTAATAGTTGTATGG + Intronic
1024498881 7:50079512-50079534 TCTACCCTATATTTGTGGTAGGG - Intronic
1027594160 7:80151947-80151969 TGTGCCCTTTAATAGCTGAAGGG - Intronic
1030745609 7:113161942-113161964 TCTACCATTTACTACTTGTTTGG + Intergenic
1031816426 7:126443415-126443437 TCTACCCTTTCATTGTAGGATGG + Intronic
1031890037 7:127283322-127283344 TTTATCCTTTAATAGTTTTTTGG + Intergenic
1032507510 7:132446794-132446816 TCTACCGCTTACTAGTTATATGG - Intronic
1035057418 7:156045225-156045247 TCTAGCATTTAATAGTTAGATGG + Intergenic
1036562630 8:9909755-9909777 TCTACTCTTTTATAGTAGTAAGG - Intergenic
1036584022 8:10106434-10106456 TCTACTGTTTAAAAGTTTTAAGG + Intronic
1037101064 8:15047046-15047068 TCTGTCCTTTGATAGTTCTAAGG + Intronic
1038570739 8:28659999-28660021 TATACGTTTAAATAGTTGTAAGG + Intronic
1038668885 8:29565244-29565266 TCTACCATTTACTAGCTGTGTGG - Intergenic
1039691457 8:39869281-39869303 TCTGTCCTTTAATAGATTTAAGG + Intergenic
1041625279 8:60018680-60018702 TCTCCCCTTTAATTGATGTTAGG + Intergenic
1041664121 8:60425787-60425809 TCTACCATTTACCAGCTGTAAGG + Intergenic
1043501445 8:80861552-80861574 TGTACACTTTAAGAGTTATACGG + Intronic
1044091844 8:88011716-88011738 TGTACCCTTTAATAATTTCAGGG - Intergenic
1045304326 8:100944864-100944886 TTTACCATTTAATAGATGCATGG - Intronic
1045781530 8:105869671-105869693 TCTTCCCTTTACTATTTGGAGGG + Intergenic
1046622131 8:116539293-116539315 TCTACCTTTTGTTAGTTGTCTGG - Intergenic
1050200303 9:3138241-3138263 TATACCCTTTAGTAGTTGTTTGG - Intergenic
1052446092 9:28563220-28563242 TCTTCCCTTTATTAGTTCTGAGG - Intronic
1054968769 9:71060538-71060560 GTTACCCCTTAATAGCTGTAGGG - Intronic
1060244469 9:121932644-121932666 TCAAACCTTTCATAGTAGTACGG + Intronic
1060451370 9:123743873-123743895 TCTACCCCTTACTAGATCTAAGG - Intronic
1186754361 X:12654617-12654639 TCTACCATGTAATAGCTGTAGGG + Intronic
1190458139 X:50644839-50644861 TCTACCATTCACTAGTTGTTTGG + Intronic
1190709565 X:53056996-53057018 TCTGCCATTTATTAGCTGTATGG + Intronic
1191710113 X:64140575-64140597 TCTTCCCTATGATACTTGTATGG + Intergenic
1193632438 X:83906614-83906636 TTTACCTTTTAATAATTTTAAGG + Intergenic
1194450252 X:94036825-94036847 TTAACCCTTTATCAGTTGTAGGG + Intergenic
1194764948 X:97838834-97838856 TCTACCATTTACTAGTTGTGCGG - Intergenic
1195262454 X:103146226-103146248 GCTTCCTTTTAATATTTGTATGG - Intergenic
1198116922 X:133553129-133553151 TCTGCCCCTTCTTAGTTGTAAGG - Intronic
1199555533 X:149104186-149104208 TCTCCCCTTTAATGGTTGTGTGG + Intergenic