ID: 1022817684

View in Genome Browser
Species Human (GRCh38)
Location 7:33929112-33929134
Sequence CAGAGTTTGCACTGTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 312}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022817684 Original CRISPR CAGAGTTTGCACTGTGAGCT GGG Intronic
901861578 1:12078084-12078106 TGGTGTCTGCACTGTGAGCTGGG + Intronic
902133186 1:14281503-14281525 CAGAGCTAGAACAGTGAGCTTGG - Intergenic
902294274 1:15455770-15455792 CAGGGGTTGCAATGTGACCTTGG - Intergenic
902297104 1:15475145-15475167 CAGGGGTTGCAGTGTGACCTTGG - Intronic
902624316 1:17667753-17667775 CAGAGCTGCCCCTGTGAGCTGGG + Intronic
903243918 1:22001979-22002001 AAGAGTTTGGACTGTGTGGTTGG + Intronic
903892342 1:26578075-26578097 CAGAGTTGACACTGGGATCTTGG - Intergenic
904765648 1:32844453-32844475 CAGGGTTTGCTCTGTAACCTAGG - Intronic
906175390 1:43766994-43767016 CAGAGTTTGGATTCTGAGTTAGG + Intronic
906218923 1:44061890-44061912 CAGAGTTTGCTCTGTCACCCAGG - Intergenic
907578870 1:55554059-55554081 CAGAGTTTTGACTGTGAGAGGGG + Intergenic
907910297 1:58819994-58820016 CGAAGTGTGGACTGTGAGCTGGG - Intergenic
908301290 1:62762869-62762891 CAGAGTTAGAAATTTGAGCTGGG + Intergenic
908570824 1:65408297-65408319 CAGTGTTGGCACTGGGATCTCGG - Intronic
908649476 1:66315891-66315913 CAGAGTTTTCACTGAGGGCTTGG + Intronic
910722173 1:90298513-90298535 AAGATTTTGCACTGTGGCCTTGG - Intergenic
910844877 1:91595157-91595179 CTGAGCTTGCACTGTGAGCCAGG - Intergenic
911063946 1:93770923-93770945 CAGAGCTTCCACTGAGAGCCGGG - Intronic
911089041 1:94002758-94002780 CAGGGTTTGCATTTTGAGGTAGG - Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
911511170 1:98809157-98809179 GACAGCTTGCACTGTGAGCCTGG - Intergenic
911855672 1:102872214-102872236 GACAGCTTGCACTGTGTGCTTGG - Intergenic
912247658 1:107977667-107977689 CAGACTTTGCCCTGTGATCCAGG + Intergenic
913155479 1:116092781-116092803 AAGAGTTTGCACAGGGAGTTGGG + Intergenic
913176666 1:116279062-116279084 CAGAGTTCACACTGAGAGCGGGG + Intergenic
915343670 1:155189129-155189151 CCGAGGTGACACTGTGAGCTGGG + Intronic
918619296 1:186583964-186583986 AAGAGTTTGCACTGTGTGCCTGG + Intergenic
920038906 1:203083612-203083634 CTGAGTTTGCCCCCTGAGCTGGG + Exonic
922886594 1:229025203-229025225 CAGGGTCTGCACCGTGGGCTTGG - Intergenic
923263150 1:232286467-232286489 AAGAGTTAGAACTGTGAGCATGG + Intergenic
923522550 1:234746939-234746961 CAGGCTGTGCACTGTGACCTGGG - Intergenic
923727265 1:236517695-236517717 CAGAGCTTGCTCTGTCACCTAGG + Intergenic
923966329 1:239143610-239143632 CTGAGTTTTTACTGTAAGCTAGG - Intergenic
924759192 1:246968473-246968495 AACAGTTTGCACTGTGTGCTTGG - Intronic
1063957220 10:11278478-11278500 CTGAGTTTGGGCTGAGAGCTGGG + Intronic
1064083651 10:12328547-12328569 CAGAGTTTGCACTGTCACCCAGG + Intergenic
1065709365 10:28500681-28500703 CAGTATTTCCACTGAGAGCTAGG + Intergenic
1068639193 10:59382980-59383002 CAGAGTATGCCCTGTGACTTTGG - Intergenic
1070610379 10:77928104-77928126 CAGAATTTGCACTTTGGACTTGG + Intergenic
1070713020 10:78697090-78697112 CAGAATTGGCACTGTGACCCAGG - Intergenic
1070956717 10:80468666-80468688 CAGAGTTTGCATTGTTAACAAGG + Intronic
1072245022 10:93535624-93535646 CAGAGTTTGAACGCTGTGCTGGG - Intergenic
1072663643 10:97379061-97379083 CAGAGCTTGCCCTGTGAGACAGG - Intronic
1072672893 10:97444227-97444249 CAGAGTTTTCTCTTTGAGCATGG + Intronic
1072724103 10:97801063-97801085 GAGAGCTTGCACTTTGAGGTAGG - Intergenic
1073184322 10:101606636-101606658 CAGACCTTGAGCTGTGAGCTGGG - Intronic
1073449068 10:103598873-103598895 CAGGGTTTGTGCTGTGAGTTAGG + Exonic
1074502908 10:114043238-114043260 AGGAGTTTGCCCTGCGAGCTTGG - Intergenic
1075314037 10:121437892-121437914 CAGAGTTTGCACCGTGAAGTGGG + Intergenic
1078303246 11:10156140-10156162 CAGAGTGGGCACTGGGAGCGAGG - Intronic
1079143887 11:17833563-17833585 GACAGCTTGCACTGTGTGCTTGG + Intronic
1079655036 11:22976216-22976238 CACAGCTTGCACTGTGTGCCTGG + Intergenic
1079716775 11:23757119-23757141 CATAGCTTGCACTGTGTGCCTGG + Intergenic
1081047831 11:38297806-38297828 CAGTGTTAGCACTTTGAGCAGGG + Intergenic
1081077640 11:38696303-38696325 GACAGCTTGCACTGTGAGCCTGG - Intergenic
1081120007 11:39255104-39255126 GACAGCTTGCACTGTGTGCTTGG - Intergenic
1081236592 11:40654266-40654288 GACATTTTGCACTGTGTGCTGGG + Intronic
1083147508 11:60770169-60770191 CAGGGTTGTCTCTGTGAGCTGGG - Intronic
1083279577 11:61618534-61618556 CAGACTGTGCACTTTGAGGTGGG + Intergenic
1085913972 11:80862600-80862622 CAGACGTTGCCCTGTTAGCTAGG - Intergenic
1086503476 11:87478009-87478031 CAGGGCATGCACTGTGAGGTTGG - Intergenic
1087093773 11:94300914-94300936 CAGAGTATGCACTCTGGGCCAGG + Intergenic
1087326313 11:96727637-96727659 CAGAGTTTGAACGCTGTGCTTGG + Intergenic
1087708442 11:101521630-101521652 GACAGTTTGCACTGTGAACCTGG + Intronic
1088048418 11:105480816-105480838 GATAGTTTGCACTGTGTGCCTGG + Intergenic
1088582860 11:111331950-111331972 CAGAGTTGGCACTTGGAGCAGGG + Intergenic
1088850978 11:113703088-113703110 AACAGCTTGCACTGTGAGCCTGG + Intronic
1089528558 11:119112452-119112474 AAGGGATGGCACTGTGAGCTGGG - Intronic
1090842814 11:130507585-130507607 GAGAGCTTGCACTGTGTGCCTGG + Intergenic
1091817852 12:3453361-3453383 TAGAGTTTGCACTGGTGGCTGGG + Intronic
1092017106 12:5168712-5168734 TAAAGTTTCCACTGTGAGCCAGG - Intergenic
1093593243 12:20931714-20931736 CAGAGTTTGAGCTGGTAGCTGGG - Intergenic
1094036932 12:26081797-26081819 AACAGCTTGCACTGTGTGCTTGG - Intergenic
1094139378 12:27164873-27164895 CAGGATCTACACTGTGAGCTTGG + Intergenic
1098475253 12:70893805-70893827 CAGAGTGGGAACTGTGAGGTTGG - Intronic
1098690251 12:73479051-73479073 CAAAATATGCACAGTGAGCTGGG + Intergenic
1099659601 12:85539389-85539411 CAGTGTTTGATCTGTTAGCTTGG - Intergenic
1101110964 12:101485564-101485586 CAGAGTTAGCACTTTTACCTAGG + Intronic
1101364543 12:104059619-104059641 CAGAATCTGGACTCTGAGCTGGG - Intronic
1101440892 12:104703650-104703672 CTGAGCTTTCACTCTGAGCTGGG - Intronic
1102211680 12:111131888-111131910 GACAGCTTGCACTGTGAGCCTGG - Intronic
1104969654 12:132525484-132525506 CAGTGTGTGCGCTGTCAGCTGGG + Intronic
1105059465 12:133135309-133135331 CAAACTCTGCACTGTGAGCTGGG + Intronic
1105674014 13:22650751-22650773 CAGAGGATGCTCTGTGAACTGGG + Intergenic
1106559302 13:30834544-30834566 CAGAGTTTTCTTGGTGAGCTGGG + Intergenic
1107328411 13:39270248-39270270 CCGAGTATGTACTGTGGGCTGGG - Intergenic
1111081887 13:83321957-83321979 CACAGCTTGCACTGTGTGCCTGG - Intergenic
1111250673 13:85597112-85597134 CAGAGTGTGCACTCTTACCTTGG - Intergenic
1111485627 13:88895554-88895576 CAGAGTGAGCACTGGGAGCAGGG - Intergenic
1112304266 13:98259509-98259531 CAGAGGTTTCACCGTGAGCAGGG + Intronic
1112334883 13:98506532-98506554 GAGACATTGCCCTGTGAGCTCGG - Intronic
1116378364 14:44232284-44232306 AATAGCTTGCACTGTGAGCCTGG - Intergenic
1117368756 14:55056533-55056555 CGGAGTTTGCACTGTCACCCAGG + Intronic
1118775172 14:68969398-68969420 CAGACTTGGCCCTGGGAGCTGGG - Intronic
1120123051 14:80705675-80705697 GAGATTTTGCACTGTTACCTGGG + Intronic
1121083938 14:91130777-91130799 AAGATTATGCACTGTTAGCTGGG - Intronic
1122122874 14:99563846-99563868 CAGAGTCTGCCCTCTGAGCACGG + Intronic
1124363277 15:29054247-29054269 CAGGGTGTGCACTGTGGGCCAGG - Exonic
1125085191 15:35721719-35721741 CAGTGTTTGCAGTGTGAGTAGGG - Intergenic
1127442284 15:59021884-59021906 CAGAGTTTGCTCTGTCACCCAGG + Intronic
1127870102 15:63065107-63065129 CAGATTGTACAATGTGAGCTTGG + Intronic
1128357757 15:66940230-66940252 CTGAGTGTTCACTGTGTGCTGGG + Intergenic
1128477075 15:68006424-68006446 CACAGCTTGCACTCTCAGCTTGG + Intergenic
1129245321 15:74275734-74275756 CAGAGGTTGCAGTGTGAGCCAGG - Intronic
1130388929 15:83437659-83437681 CAGAGGTTGCACTAACAGCTGGG - Intergenic
1131285051 15:91049952-91049974 TTGAGTGTGCACTGTGAACTGGG - Intergenic
1131863112 15:96675792-96675814 CAGAGTGGGCACAGTGGGCTAGG - Intergenic
1133628492 16:7594384-7594406 CAGATTTTTCACTGTAAACTGGG - Intronic
1134159242 16:11872887-11872909 CAGAGTTTGAAGTGAGGGCTAGG + Exonic
1134363856 16:13558157-13558179 CCGAGTTTGCTGTGTGATCTTGG + Intergenic
1135925981 16:26694585-26694607 AACACTTTGCACTGTGTGCTTGG - Intergenic
1136573827 16:31111787-31111809 CAGACTTTGCACTGTCTGCTTGG + Intronic
1136882707 16:33912842-33912864 CAGAGTATCCACTGTGTGCCAGG + Intergenic
1137504504 16:49041388-49041410 CAGAGCTGGCACTGGGACCTAGG - Intergenic
1137679167 16:50324191-50324213 CAGGGTTTGCACACTGAGCCTGG - Intronic
1138539143 16:57678009-57678031 CAGAGCTTGCACTGTGCCCCAGG + Intronic
1138652954 16:58472204-58472226 CAGAGTATTCACTCTGTGCTTGG + Intronic
1138998162 16:62477856-62477878 CAGAGCTGGCACTGGGAGCAGGG - Intergenic
1139058399 16:63217363-63217385 CTGAGTTAGCACTGGCAGCTTGG - Intergenic
1139894348 16:70276187-70276209 CAGAGCTTGCTCTGTCAGCTAGG - Intronic
1140551537 16:75871123-75871145 CAGAGTTTGGGGTGTAAGCTGGG + Intergenic
1141611543 16:85183952-85183974 CCGAGTTTTTACTGGGAGCTTGG - Intronic
1142912201 17:3103747-3103769 CAGTGTTTCCACTGCAAGCTTGG - Intergenic
1143090162 17:4445289-4445311 CAGGGATTGCACTGAGGGCTGGG + Intronic
1144538482 17:16114838-16114860 TACAGTTTGCACTGTGTGCCTGG - Intronic
1147191378 17:38739995-38740017 CCTTGTTTGCACTGTGGGCTTGG - Intronic
1148072680 17:44917182-44917204 CTGAGCTGGCTCTGTGAGCTGGG - Intergenic
1149369398 17:55978233-55978255 GACAGTTTGCACTGTGTGCCTGG - Intergenic
1149600509 17:57890352-57890374 CAGAGCTGGCTCTGTGACCTTGG + Intronic
1149609677 17:57950925-57950947 GAGAATTTGCCCTGTAAGCTGGG - Intronic
1151513733 17:74578904-74578926 CAGAGCTAGAACTGTGAGCTGGG - Intergenic
1152084291 17:78208120-78208142 AAGAATTTCCACTGTGGGCTGGG + Intergenic
1153293626 18:3525066-3525088 CAGAGTTTCCACAGTGTTCTGGG + Intronic
1156185207 18:34654750-34654772 CAGAGTTTGCTCTGTCACCCAGG + Intronic
1156976578 18:43228893-43228915 CAGAGTTTCCACTATGCTCTGGG + Intergenic
1158190819 18:54826699-54826721 CACAGTGACCACTGTGAGCTCGG + Intronic
1159262867 18:66038437-66038459 AAGATTTTGTACTGTAAGCTAGG - Intergenic
1159697301 18:71575774-71575796 GACAGTTTGCACTGTGTGCCTGG - Intergenic
1161105316 19:2440946-2440968 CAGGGAGGGCACTGTGAGCTGGG - Intronic
1162333811 19:10047558-10047580 CAGAGTTTGCTCTGTCACCCAGG + Intergenic
1164127142 19:22328837-22328859 CACAATTTCAACTGTGAGCTGGG - Intergenic
1164260156 19:23562426-23562448 CACAATTTTCCCTGTGAGCTGGG + Intronic
1165010491 19:32842910-32842932 GAGAGTTTTCAATGTGGGCTGGG + Intronic
1165067783 19:33239150-33239172 CAGATCTTGCAGTGTGTGCTGGG - Intergenic
1165942417 19:39421619-39421641 CAGAGGTTGCAAAATGAGCTGGG + Intronic
1168469935 19:56631432-56631454 CACAGCTTGGACTGTGGGCTGGG - Intergenic
925778426 2:7357211-7357233 CAGAGTTGGTCCTGTCAGCTTGG - Intergenic
926355811 2:12039768-12039790 TAGCCTTTGCTCTGTGAGCTGGG + Intergenic
926791352 2:16574960-16574982 AAGAGTTTACACTGTGTGCCTGG + Intronic
926813241 2:16775058-16775080 CAGAGTTAGATCTCTGAGCTAGG + Intergenic
929190867 2:39138268-39138290 CAGCGCATGCACTGTGAGCCTGG + Intergenic
929765183 2:44838223-44838245 CAGGGTTAGCGCTGTGAGCTGGG + Intergenic
931159145 2:59669082-59669104 CAGAAATTGTACTGTGAGGTAGG + Intergenic
931714401 2:65017643-65017665 CAGAAATGGCTCTGTGAGCTTGG - Intronic
932417197 2:71580531-71580553 CAGAGCTGGCACTGTGAGCAAGG + Intronic
934066082 2:88343231-88343253 CAGAGACTGCACTGTTACCTTGG - Intergenic
934924197 2:98370449-98370471 CTGGGTTTGCAGTCTGAGCTGGG + Intronic
937528275 2:122797495-122797517 CACAGTTTTTACTCTGAGCTTGG + Intergenic
937764836 2:125649082-125649104 CAGGCTCTGCAATGTGAGCTGGG + Intergenic
938900760 2:135796912-135796934 CAGGGTGTGCATTGTGAGGTGGG + Intronic
943124804 2:183782986-183783008 GACAGCTTGCACTGTGAGCCTGG + Intergenic
946614903 2:221498815-221498837 CAGAGTTTCCTCTGTCATCTAGG + Intronic
947018656 2:225649443-225649465 CAGAGTATCCACTGTGTTCTGGG - Intronic
947452069 2:230217718-230217740 CATAGTTAGCACTGTAAGCCTGG - Intronic
948292634 2:236837469-236837491 CAGAGTCTGCACTCTGGACTGGG + Intergenic
1173455909 20:43201142-43201164 CAGAGTGTGCCCTGTGTGCTGGG + Intergenic
1173557107 20:43974010-43974032 CAGATTTTCCACTGAGAGCCTGG + Intronic
1174874382 20:54211214-54211236 CGGAGTCTGCACTGACAGCTGGG - Intronic
1175015961 20:55790826-55790848 CTGAGTGTTCACTGTGTGCTGGG - Intergenic
1175358970 20:58392016-58392038 CAGAGTTTGTACTGGGATTTGGG - Intronic
1175776332 20:61656169-61656191 CAGGGTTTGCACTCTTAGTTAGG + Intronic
1175883564 20:62274604-62274626 CAGAGTGAGCTCTGTGTGCTGGG - Intronic
1177187588 21:17815040-17815062 CAGATTTTGTACTGTGGGCATGG - Intronic
1177478198 21:21651326-21651348 GACAGCTTGCACTGTGAGCCTGG + Intergenic
1178013743 21:28318134-28318156 GACAGCTTGCACTGTGAGCTTGG + Intergenic
1178021039 21:28408394-28408416 AAGAGTTGGCCCTGTGAGTTTGG - Intergenic
1178207300 21:30485021-30485043 GGGAGTTTGCTCTCTGAGCTGGG + Intronic
1180705562 22:17807911-17807933 CAGCGTTTAAATTGTGAGCTGGG - Intronic
1181314071 22:21960729-21960751 CAGAATAAGCACTGTGACCTTGG - Intronic
1181340844 22:22178764-22178786 CTCAGTCTGCAGTGTGAGCTGGG + Intergenic
1181816934 22:25445550-25445572 AAAAGTTTGATCTGTGAGCTGGG - Intergenic
1184583121 22:45430340-45430362 CAGAGTTTTCACAGTGAGGAGGG + Intronic
953158672 3:40398140-40398162 CAGACTTTGCTCTGTGAGACTGG - Intronic
953976637 3:47386459-47386481 AAGAGTGTGCACTGTGGGCTGGG - Intronic
954229481 3:49205617-49205639 CAGAGTTTGCTCTGTTACCCAGG + Intronic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955662184 3:61312920-61312942 TAGAATTTCCAGTGTGAGCTGGG + Intergenic
957870279 3:86082957-86082979 CAGAGCTTGCACCGTGAGCCTGG - Intergenic
957974303 3:87423704-87423726 AAGAGTGTGCACTGTGTTCTGGG - Intergenic
959389807 3:105759682-105759704 CAGAGCAGGCACTGTGAGCAGGG + Intronic
959468957 3:106724813-106724835 AAAAGTTTGGATTGTGAGCTGGG - Intergenic
959960093 3:112288454-112288476 CAGAGTATGCACTTTTACCTTGG - Intronic
960157396 3:114309829-114309851 CAGAGGTTGGACTGAGAGTTGGG + Exonic
960494182 3:118355175-118355197 GACAGTTTGCACTGTGCACTTGG + Intergenic
960817361 3:121687900-121687922 CTGACTTTGCCCTGGGAGCTTGG - Intronic
963404379 3:144843991-144844013 GACAGCTTGCACTGTGAGCCTGG - Intergenic
965058457 3:163752453-163752475 CAGAGTGAGTACTGTGCGCTGGG + Intergenic
966417382 3:179703478-179703500 GAGACATAGCACTGTGAGCTCGG + Intronic
966686181 3:182698444-182698466 CAGAGTTTGCTCTGTCACCTAGG + Intergenic
970492441 4:16588229-16588251 CAGATTTAGCACTGTGATCAGGG + Intronic
973652697 4:53012418-53012440 CAGAGGCTGCACTGTGATCCTGG + Intronic
973768761 4:54187846-54187868 CAGAGTCTGCTCTGTGACCCAGG - Intronic
975186561 4:71410245-71410267 CACAGCTTGCACTGTGTGCCTGG + Intronic
975299635 4:72774872-72774894 CAGAGTGGGCACTGGGAGCAGGG - Intergenic
975542852 4:75532451-75532473 AACAGCTTGCACTGTGAGCCTGG - Intronic
976287521 4:83384835-83384857 GACAGTTTGCACTGTGTGCCTGG - Intergenic
977027131 4:91833941-91833963 CAGAGTTTCCACTGTGGTTTGGG + Intergenic
978210752 4:106132627-106132649 GAGAGCTTGCACTGTGAGCCTGG + Intronic
978975849 4:114870834-114870856 CAGAGTTTGCAATTTCAGGTTGG + Exonic
979139182 4:117151025-117151047 AACAGTTTGCACTGTAAGCCTGG - Intergenic
979367974 4:119848088-119848110 GGCAGTTTGCACTGTGAGCCTGG - Intergenic
979435755 4:120687869-120687891 CAGTGCTTGCACTTTGATCTTGG + Intronic
979524831 4:121705902-121705924 AAGAATTTGCACCGTGAGCTTGG + Intergenic
979862694 4:125714106-125714128 CAGATTTTGCACTTAGTGCTTGG + Intergenic
980707581 4:136519834-136519856 CACAGCTTGCACTGTGTGCTTGG - Intergenic
980901419 4:138908698-138908720 CAGAGTTTGTATTGTGAGCAAGG + Intergenic
981643080 4:146967504-146967526 TACAGTTTGCACTGTGTGCCTGG + Intergenic
981737652 4:147969933-147969955 CAGATTCTTCACTGTGTGCTTGG + Intronic
982076054 4:151738098-151738120 GACAGTTTGCACTGTGTGCCTGG + Intronic
983413217 4:167424224-167424246 CACAGTTTGTTCTGTCAGCTTGG + Intergenic
983769036 4:171525129-171525151 CAGAGTTTGCCTTGTGTGTTGGG - Intergenic
984090613 4:175369832-175369854 CAGAGCTTGCTCAGTGAGCCGGG - Intergenic
984262203 4:177455554-177455576 CAGAGTTTCCACTGTGAAGCGGG - Intergenic
986146600 5:5083596-5083618 CAGATTTGGCACAGTGAGCAGGG + Intergenic
986323027 5:6649234-6649256 CAGAGCTCGAACTGTGTGCTGGG + Intronic
987082346 5:14436904-14436926 CACAGCTTGCACCGTGAGCCTGG - Intronic
987510358 5:18829030-18829052 GACAGTTTGCACTGTGTGCCTGG + Intergenic
988134913 5:27158307-27158329 AACAGCTTGCACTGTGAGCCTGG + Intergenic
988317049 5:29644197-29644219 TACAGCTTGCACTGTGAGCCTGG + Intergenic
989753455 5:44922914-44922936 CACAGCTTGCACTGTGTGCCTGG + Intergenic
991373789 5:65944425-65944447 CAGAGTTTGCTCTGTCACCCAGG + Intronic
991498904 5:67256330-67256352 AAGAGTCTGCCCTGTGTGCTGGG + Intergenic
991603724 5:68379504-68379526 CTGGGTTTGAACTGTGACCTTGG - Intergenic
992506017 5:77388584-77388606 CAGAGCTTGCACGCTGTGCTGGG + Intronic
992817863 5:80463054-80463076 AACAGCTTGCACTGTGTGCTTGG - Intronic
992876923 5:81065492-81065514 CAGACCTTGCACTGTCAGCTGGG + Intronic
993105258 5:83592953-83592975 CAGAGGCTGCTCTGGGAGCTGGG + Intergenic
994261148 5:97660263-97660285 CAGATTTGCCACTGAGAGCTGGG + Intergenic
994592401 5:101789448-101789470 GACAGTTTGCACCGTGAGCCTGG + Intergenic
995090294 5:108167526-108167548 TAGAGCTTGCAGTGGGAGCTAGG - Intronic
995872413 5:116756800-116756822 GACAGCTTGCACTGTGAGCCTGG + Intergenic
996157139 5:120115636-120115658 AACAGTTTGCACTGTGAACCTGG + Intergenic
996191749 5:120552285-120552307 CAGTGATTGCACTGGGAACTAGG + Intronic
996438997 5:123468268-123468290 CAGAGGGTGCACTGTGAGGCTGG - Intergenic
998980595 5:147697977-147697999 AACAGCTTGCACTGTGTGCTTGG + Intronic
999451464 5:151681375-151681397 CTGAATTCGCACAGTGAGCTGGG - Intronic
1003397247 6:5763945-5763967 CAGAGTTTGGACTCTGACTTTGG - Intronic
1004074595 6:12333480-12333502 AAAAGTTTGCACTGAGAGCCAGG + Intergenic
1005984086 6:30859750-30859772 CACAGCTTGCACTGTGTGCCTGG - Intergenic
1007468754 6:42074389-42074411 TAGAGATGGCACTGAGAGCTGGG + Intronic
1007631747 6:43276706-43276728 CAGGGTCTACACTGAGAGCTGGG - Intronic
1007719245 6:43875651-43875673 CAGAGGTTGGTGTGTGAGCTGGG + Intergenic
1009346144 6:62614570-62614592 GAGAGCTTGCACTGTGAACCTGG + Intergenic
1009459739 6:63897987-63898009 GAGAGTTTACACTGTGACCGTGG + Intronic
1009463014 6:63936484-63936506 CAGACTATGCACAGTAAGCTGGG - Intronic
1009900965 6:69807619-69807641 CATAGCTTGCACTGTGTGCCTGG - Intergenic
1010248302 6:73682540-73682562 CACAGCTTGCACTGTGTGCCTGG - Intergenic
1010549307 6:77201409-77201431 GACAGTTTGTACTGTGTGCTTGG + Intergenic
1010610823 6:77952218-77952240 GACAGTTTGCACTGTGTGCCTGG + Intergenic
1012078632 6:94727442-94727464 CAGAGTTTGCACTGTGCACCTGG - Intergenic
1012768320 6:103397354-103397376 CATAGCTTGCACTGTGTGCCTGG + Intergenic
1012830837 6:104201811-104201833 AACAGCTTGCACTGTGAGCCTGG + Intergenic
1013669435 6:112383216-112383238 CACAGTTTGGACTGTGGCCTGGG - Intergenic
1016512999 6:144864234-144864256 GACAGCTTGCACTGTGTGCTTGG + Intergenic
1018573036 6:165230662-165230684 CAGAGCTTGCGCTGGGAGCATGG - Intergenic
1018663140 6:166107383-166107405 CAGAGGTTGCAGTGAGCGCTGGG - Intergenic
1018807805 6:167274854-167274876 AGCAATTTGCACTGTGAGCTTGG - Intronic
1020546649 7:9541220-9541242 AACAGCTTGCACTGTGAGCCTGG + Intergenic
1020786788 7:12583670-12583692 CAGAGTTTCCACTATGGGCCAGG + Intronic
1021638526 7:22715087-22715109 CAGAGGGTCCACTGTGAGCTAGG - Intergenic
1022081719 7:27029071-27029093 CAGAGTTCTTACTGTGAGCCAGG - Intergenic
1022469600 7:30674236-30674258 CAGAGCTTACACAGTGAGCTGGG - Intronic
1022794309 7:33719757-33719779 CAGGGTGTGCACTGGGACCTTGG - Intergenic
1022817684 7:33929112-33929134 CAGAGTTTGCACTGTGAGCTGGG + Intronic
1023307809 7:38849559-38849581 CAGAGTTTGGCCTGGGAGGTTGG - Intronic
1024512998 7:50217847-50217869 TCGAGGTTGCACTGTGTGCTTGG + Intergenic
1024894281 7:54239494-54239516 CAGAGTATGAAATGTGACCTAGG + Intergenic
1025639108 7:63350600-63350622 CAGACTTAGCACTGTGAACTGGG + Intergenic
1025643591 7:63397492-63397514 CAGACTTAGCACTGTGAACTGGG - Intergenic
1025713178 7:63930524-63930546 CAGACTTAGCACTGTGAACTGGG - Intergenic
1026223586 7:68421488-68421510 CAGAGTTTGCACTGTCACCCAGG - Intergenic
1026290039 7:68997979-68998001 CAAAGTTTGCTCTGTCAGCCAGG + Intergenic
1026887563 7:73962217-73962239 CAGAGTTTGCTCTGTCACCCAGG + Intergenic
1029191031 7:98772506-98772528 CAGAATTTGCACAGTTTGCTGGG - Intergenic
1029878024 7:103773942-103773964 CTTATTTAGCACTGTGAGCTAGG + Intronic
1030210525 7:106991242-106991264 CAGACCTTGGACTGGGAGCTGGG - Intergenic
1031640827 7:124161716-124161738 CAGAGTGTGCACTCTGAGAAAGG + Intergenic
1031722500 7:125193973-125193995 GACAGCTTGCACTGTGAGTTTGG + Intergenic
1031886649 7:127251895-127251917 CCGAGTTAGCACGGCGAGCTTGG - Intronic
1032014284 7:128367226-128367248 CAGAGTCTGCTCTGTCACCTAGG + Intergenic
1032658400 7:133955876-133955898 CAGAGTGGGCACTGGGAGCAGGG + Intronic
1033437943 7:141351257-141351279 CTGAGTTGGCAGTGTGATCTGGG + Intronic
1033716697 7:144009921-144009943 CACAGTTTGCACTGTGCACCTGG + Intergenic
1034040701 7:147874124-147874146 GAGAGCTTGCACCGTGAGCCTGG - Intronic
1034138105 7:148790207-148790229 CTGACTTTGTACTGTAAGCTTGG + Intronic
1034740788 7:153471625-153471647 TAGAGTGAGCACTGTGAGCCGGG + Intergenic
1035711147 8:1715604-1715626 CAGAACTTGCAGTGTGAGCTGGG - Intergenic
1035915920 8:3622083-3622105 CACAGTCTGCACTATGTGCTGGG + Intronic
1037424797 8:18743932-18743954 CAGAGTTTGCACTTTCACCCAGG - Intronic
1038692906 8:29779525-29779547 AAGAGTTTGCACTGTGGCCAAGG - Intergenic
1039142328 8:34403742-34403764 CACAGTTTGCTCTGTGAGCTGGG + Intergenic
1039252414 8:35681415-35681437 CAGAGATTGTACTGAGAGCTGGG - Intronic
1040736610 8:50515922-50515944 CAGAGCTTGCACTCTGTGCTGGG - Intronic
1041313816 8:56541573-56541595 CTGAGTGTGCACTGTGTGCCTGG - Intergenic
1042070918 8:64932256-64932278 CTGATTTTGAACAGTGAGCTTGG + Intergenic
1042161888 8:65904989-65905011 AAGAGCTTGCACTGTGTGCCTGG + Intergenic
1042254673 8:66790734-66790756 CAGAGACTGCAATGTGGGCTGGG - Intronic
1042721827 8:71834443-71834465 CTGAGTCTGCACTGTCAGCTGGG + Intronic
1042856538 8:73273351-73273373 CAGAGTGGGCACTGGGAGCTGGG - Intergenic
1045207464 8:100056930-100056952 AACAGTTTGCACTGTGTGCCCGG + Intronic
1045303600 8:100936732-100936754 CAGAGGTTGCAAAGTGAGCCAGG + Intronic
1045919345 8:107511387-107511409 AACAGCTTGCACTGTGAGCCTGG + Intergenic
1047194962 8:122712894-122712916 GACAGTTTGCACTGTGTGCCTGG + Intergenic
1048063587 8:130945803-130945825 CAGAGTATTCACTGTGGACTTGG + Intronic
1048783013 8:138022125-138022147 GACAGTTTGCACCGTGAGCCTGG + Intergenic
1049246546 8:141565799-141565821 CAGACTTTGCTCTGTGAGGGTGG + Intergenic
1049251879 8:141593538-141593560 GGGGATTTGCACTGTGAGCTGGG + Intergenic
1049280637 8:141742379-141742401 CTGAGTGTGCACAGTGAGTTAGG + Intergenic
1049726349 8:144148205-144148227 CAGCGTTCGCCCTGTGACCTTGG - Intronic
1050905149 9:10994109-10994131 AACAGCTTGCACTGTGAGCCTGG + Intergenic
1052168011 9:25357496-25357518 GACAGTTTGCACTGTGCACTTGG - Intergenic
1052594163 9:30537123-30537145 GACAGCTTGCACTGTGAGCCTGG + Intergenic
1054855936 9:69899758-69899780 CAGAGTTTTTACTGGGAGCTGGG - Intronic
1055898966 9:81212676-81212698 CAGGATTGGCACTTTGAGCTGGG + Intergenic
1056961662 9:91130052-91130074 CAGAATTTACCCTGTGAACTAGG + Intergenic
1057518194 9:95738856-95738878 CCGAGTCTGCACTGTCACCTTGG - Intergenic
1057780394 9:98045085-98045107 CAGAGTCTGCTCTGTCACCTAGG - Intergenic
1058492404 9:105516317-105516339 CAGAGCTTGAACTCTGTGCTTGG - Intronic
1058568857 9:106318739-106318761 CAGAGTTTGTGCTGTGCTCTGGG - Intergenic
1060114034 9:120927013-120927035 CAGAATGTGTACTGTGTGCTGGG + Exonic
1062157843 9:135063639-135063661 GACAGTTTGCACTGTGTGCCTGG - Intergenic
1188083757 X:25878216-25878238 CTGAGTTTGCAGTTTGAGTTTGG - Intergenic
1188804450 X:34570224-34570246 GACAGTTTGCACTGTGTGCCTGG - Intergenic
1189100802 X:38187531-38187553 CATAGTTTACACTTTGAGGTAGG + Intronic
1189235011 X:39480128-39480150 CAGAAGGTGCCCTGTGAGCTGGG + Intergenic
1189843367 X:45106147-45106169 CAAAGATTGCACTCTCAGCTTGG - Intronic
1190286964 X:48967703-48967725 AAGAGTATGCAGTGTGATCTTGG - Intronic
1190465078 X:50718089-50718111 CTGAGTGTCCACTGTGTGCTGGG + Intronic
1191188616 X:57640460-57640482 AACAGTTTGCACTGTGTGCCTGG + Intergenic
1193161308 X:78232575-78232597 CAGAGCTCGCACACTGAGCTGGG + Intergenic
1193329688 X:80222544-80222566 AACAGCTTGCACTGTGTGCTTGG + Intergenic
1193943881 X:87708697-87708719 GACAGTTTGCACTGTGTGCCTGG - Intergenic
1194264566 X:91738756-91738778 GACAGTTTGCACTGTGTGCCTGG + Intergenic
1194603856 X:95957480-95957502 GACAGCTTGCACTGTGCGCTTGG + Intergenic
1196559355 X:117126878-117126900 AACAGCTTGCACTGTGAGCCTGG + Intergenic
1196664796 X:118304930-118304952 CACAGCTTGCACTGTGTGCCTGG - Intergenic
1196799977 X:119533682-119533704 CAGATATTGCACTAGGAGCTGGG - Intergenic
1197581942 X:128294523-128294545 GAGAGTTTGCACTGTGCACCTGG + Intergenic
1198520302 X:137445729-137445751 CAGACCTGGCACTGTGTGCTGGG - Intergenic
1199011133 X:142760208-142760230 CTGAGCCTGCACTGTGAGCCAGG - Intergenic
1202340639 Y:23861282-23861304 CAGAGTGGGCACTGGGAGCTTGG - Intergenic
1202530127 Y:25808800-25808822 CAGAGTGGGCACTGGGAGCTTGG + Intergenic