ID: 1022819858

View in Genome Browser
Species Human (GRCh38)
Location 7:33948868-33948890
Sequence CTGTGAGATAAGCAGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 387}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022819858 Original CRISPR CTGTGAGATAAGCAGGAAGG AGG Intronic
901081208 1:6585316-6585338 CTGGGAGAGAAGCAGGCAAGGGG + Intronic
901384288 1:8897092-8897114 CTGTTTGTTAAGCAGGGAGGAGG - Intergenic
901874940 1:12162047-12162069 CGCTGAGATAAGCAGGACTGAGG + Intergenic
902118295 1:14139984-14140006 GTGTGTGTTAAGTAGGAAGGAGG + Intergenic
902160507 1:14526605-14526627 CAGGGAGATAAGAATGAAGGAGG - Intergenic
903163786 1:21507328-21507350 CTTTGGGATAAGGAGGCAGGGGG + Intergenic
903666626 1:25011939-25011961 GTGTGAGACAAGAAGGAGGGGGG - Intergenic
904246783 1:29193730-29193752 ATGACAGAAAAGCAGGAAGGGGG + Intronic
904965486 1:34369439-34369461 CTCAGGGATAAGCAGGAAGAGGG - Intergenic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906800136 1:48729895-48729917 CTGAGAGACAAGAAGGTAGGAGG + Intronic
907265239 1:53255350-53255372 CTGTGAGGCAAGCAGGACAGAGG + Intronic
907644109 1:56224407-56224429 CCGTGCGATAACCAAGAAGGTGG + Intergenic
908448450 1:64225304-64225326 CTGTGAGAGAATCAGTAAGAAGG + Intronic
908754277 1:67453918-67453940 CTATGCGATAAGCAGGGAGTGGG - Intergenic
910015184 1:82514984-82515006 CTCTGAGCAAAGCAGGAAGTGGG + Intergenic
910709559 1:90165670-90165692 CTGTGAGATAGTCAAGTAGGAGG - Intergenic
911926215 1:103835634-103835656 CTGTGAAATCATCTGGAAGGGGG + Intergenic
912379914 1:109241756-109241778 CTCTGAGACAAGATGGAAGGAGG - Intergenic
912890850 1:113528577-113528599 CTTTGAGATTAGCAGGAAATTGG + Intronic
913211732 1:116588255-116588277 CTGGGAGCTAAGGAAGAAGGGGG + Intronic
915519560 1:156433869-156433891 CTGGGGGAGAAGCAGGCAGGAGG - Intergenic
915706599 1:157849652-157849674 CTGAGAGAGAGGCAAGAAGGAGG + Intronic
917086695 1:171311196-171311218 CTGTTTGTTAAGCAGGGAGGAGG - Intergenic
918154338 1:181831104-181831126 CTGTTTGTTAAGCAGGGAGGAGG - Intergenic
918371547 1:183866618-183866640 CTGTGAGGTGAGCAGGAAGGTGG + Intronic
918886186 1:190197723-190197745 CTGTGAAATCAGCCAGAAGGAGG - Intronic
920010796 1:202866173-202866195 CTGAGAGCTAAGCAGGCAGCTGG - Intergenic
920365757 1:205447631-205447653 CTGAGTGACAAGCAGGACGGGGG + Intronic
920376531 1:205511643-205511665 CTGTTAGATAACCCAGAAGGTGG - Intronic
922100968 1:222476593-222476615 CTGGGAGACAAGCAGGAATCTGG + Intergenic
922334406 1:224606940-224606962 CTGCCAGTCAAGCAGGAAGGGGG + Intronic
923307060 1:232698058-232698080 CTTTTAGAAAAGCGGGAAGGAGG - Intergenic
923830431 1:237549693-237549715 CTTTAAGATAAGCAGGAATTGGG - Intronic
924105513 1:240645291-240645313 CTGTGAGACTAGAAGCAAGGTGG + Intergenic
924543726 1:245005866-245005888 ATGGGAGATAGCCAGGAAGGAGG + Intronic
924742847 1:246806929-246806951 ATGTGATAAAACCAGGAAGGAGG + Intergenic
1063077768 10:2733428-2733450 CTGTGACAGATGCAGGAAGCAGG + Intergenic
1063113544 10:3056902-3056924 CAGTGGGATTAGCAGGAAGCGGG + Intergenic
1063366382 10:5493370-5493392 CTGGAAGCTAAGCAGGAATGTGG + Intergenic
1064321493 10:14309671-14309693 CTGTTAGATATGGAGGCAGGAGG - Intronic
1064634028 10:17345529-17345551 CTGTTTGAGAAGCAGGAAGGAGG + Intronic
1067461542 10:46461970-46461992 CTGGAAGAGGAGCAGGAAGGTGG + Exonic
1067625652 10:47922631-47922653 CTGGAAGAGGAGCAGGAAGGTGG - Intergenic
1069830330 10:71278966-71278988 AGGTGAGACAAACAGGAAGGGGG - Intronic
1069848308 10:71388439-71388461 ATGGCACATAAGCAGGAAGGGGG - Intergenic
1070282279 10:75058555-75058577 ATGAGAGAGAAGCAGGATGGGGG + Intergenic
1070414594 10:76177970-76177992 ATGTGAGCTAAGCAGCATGGGGG - Intronic
1070747925 10:78946043-78946065 CAGTGAGAGAAGCAGGATAGGGG - Intergenic
1071033681 10:81216344-81216366 CTGTGACATACGCAGGAGGAAGG - Intergenic
1072370911 10:94765715-94765737 CTGTTTGTTAAGCAGGGAGGAGG + Intronic
1072389863 10:94972310-94972332 CTCTAAGAGAAACAGGAAGGAGG - Intronic
1073482734 10:103797276-103797298 CTGTGAGAGAAGAAGGTGGGTGG + Intronic
1073553846 10:104428776-104428798 ATGTGAGATGGACAGGAAGGCGG + Intronic
1073641599 10:105258060-105258082 AGGAGAGATAAGCAGGAAGAAGG - Intronic
1073641783 10:105260201-105260223 TTGTGAGAAAAGCAGGAAAGGGG + Intronic
1075811750 10:125229136-125229158 CTCTGAGATTTGCAGGCAGGAGG - Intergenic
1077147689 11:1053300-1053322 CTGTGGGAACTGCAGGAAGGAGG - Intergenic
1078347478 11:10563658-10563680 CTATAAGATAAGCAGGCAGAAGG - Intronic
1078723726 11:13908775-13908797 CTGTGAGATTAGAAGGCAGAAGG - Intergenic
1082803164 11:57429164-57429186 GTGTGAGATGATGAGGAAGGAGG - Intergenic
1083394327 11:62379403-62379425 CAGTGAGATAAATAGAAAGGAGG - Intronic
1083777579 11:64901838-64901860 TGGTGAGAGAAGCAGGCAGGAGG - Intronic
1084033754 11:66495607-66495629 CTGTGAGAGGGGCAGGCAGGTGG - Intronic
1084537907 11:69768686-69768708 CTGTGGGATGGGCAGGGAGGAGG - Intergenic
1084937446 11:72594704-72594726 ATGTGAGCAAGGCAGGAAGGAGG - Intronic
1085453538 11:76653343-76653365 CTGTCAGCTAAGACGGAAGGAGG - Intergenic
1085737953 11:79055820-79055842 CAGTGAGATAACTTGGAAGGAGG - Intronic
1085752890 11:79177609-79177631 GAGTGGGATAAGGAGGAAGGAGG + Intronic
1085777048 11:79376448-79376470 CTGTAAGATAAGTAGGAGTGAGG - Intronic
1085840277 11:80003655-80003677 CTTGTAGATAAGCAGGAAGAAGG + Intergenic
1087075491 11:94124068-94124090 CTGTTTGTTAAGCAGGGAGGAGG - Intergenic
1088368773 11:109066366-109066388 TTGTGAGATGGGAAGGAAGGTGG + Intergenic
1088493045 11:110405269-110405291 CTGTTTGTTAAGCAGGGAGGAGG - Intergenic
1088966333 11:114725402-114725424 CAGTGAGATGAGGAAGAAGGAGG - Intergenic
1089090811 11:115873281-115873303 CTGAGACATCAGCAAGAAGGTGG - Intergenic
1089410054 11:118233399-118233421 CTCTTAGGTAAGCAGGAAAGTGG + Intronic
1089543883 11:119206981-119207003 CTGGGAGGTTAGCAGGGAGGGGG + Intronic
1090317345 11:125804852-125804874 CTTTGAAATAACCAGAAAGGTGG - Intergenic
1090630592 11:128644036-128644058 CTCTCAGATGGGCAGGAAGGCGG - Intergenic
1090987890 11:131788698-131788720 CTGTGAGGTAAGTGGGGAGGAGG - Intronic
1091444530 12:535925-535947 CTGGGGGATAAGGAGGAAGAGGG + Intronic
1091849398 12:3683099-3683121 AAGTGAGATAAGCAGGGTGGAGG + Intronic
1091883171 12:3996407-3996429 CTGAGAGAGAAGAAGGAAGGAGG - Intergenic
1094253628 12:28396184-28396206 CTGAGAGATTAGCATGAAAGAGG + Intronic
1094439413 12:30458050-30458072 CTGTGACATAGGGAAGAAGGAGG - Intergenic
1094676872 12:32628862-32628884 ATCTGAGATAAACAGGAAAGTGG + Intronic
1095297359 12:40542251-40542273 CTGTGAGATAGAAAGGAGGGGGG - Intronic
1095349830 12:41196210-41196232 CTGTAAGATAAAAAGTAAGGAGG + Intronic
1095742622 12:45623477-45623499 CTGTGGGATACATAGGAAGGAGG + Intergenic
1097374047 12:58819283-58819305 CTGAGAGAGAAGCTGGAAAGAGG - Intergenic
1097401495 12:59133962-59133984 CTGTGACAAAAACAGCAAGGGGG + Intergenic
1098221804 12:68277981-68278003 CTGTGAGCTGAGCAAGGAGGTGG - Intronic
1098578943 12:72076050-72076072 CTGTGAGGTAAGCCGGCAGGGGG + Intronic
1099376992 12:81904065-81904087 CTGTTTGCTAAGCAGGGAGGAGG - Intergenic
1099916632 12:88903208-88903230 CATTGAGATTAGAAGGAAGGTGG + Intergenic
1100391318 12:94148442-94148464 CGGTGAGATAGGGAGGAGGGAGG - Intergenic
1100529447 12:95450362-95450384 CTGTTTGTTAAGCAGGGAGGAGG + Intergenic
1101074500 12:101114608-101114630 CTGTGAGATAAGAGTGCAGGAGG + Intronic
1101817948 12:108160168-108160190 CTGTGAGTTCTGCAGGAAGATGG + Intronic
1102233455 12:111279321-111279343 CTGTGAGACAGGCAGGACCGAGG - Intronic
1104460514 12:128952162-128952184 CTGGGAGATGGGCAGGAAGCAGG + Intronic
1104975322 12:132549574-132549596 CTCTGAGAGAGGCAGGAAGGAGG + Intronic
1104988449 12:132610800-132610822 CCCTGAGATCAGCAGGCAGGGGG - Intergenic
1105214990 13:18278881-18278903 CTGGGAGCTAAGAAAGAAGGGGG + Intergenic
1105912093 13:24878687-24878709 CTGGGAGACAGGCAGAAAGGGGG - Intronic
1107788457 13:43977638-43977660 ATGGGAGAGAAGGAGGAAGGAGG - Intergenic
1107860504 13:44655790-44655812 CTGCGAGCTGAGCAGCAAGGTGG - Intergenic
1110113049 13:71775039-71775061 CTTTGAGAGATGGAGGAAGGAGG + Intronic
1110422665 13:75330921-75330943 GTCTGAGATAACCAGGCAGGTGG - Intronic
1110872818 13:80472282-80472304 CTTTGAGAGAAGGAGGCAGGTGG + Intergenic
1113816047 13:113171922-113171944 CTGTGAGAGAAGCAGCGTGGCGG + Exonic
1115771181 14:36664976-36664998 GTGTGAGATCAGCAGAAATGGGG + Intronic
1116698109 14:48202119-48202141 CTGTTTGTTAAGCAGGGAGGAGG - Intergenic
1117162400 14:53002231-53002253 CTGGGAGATGAGAAGGAGGGAGG - Intergenic
1117438032 14:55736013-55736035 ATGAGACATGAGCAGGAAGGAGG + Intergenic
1119720102 14:76884696-76884718 CTGGGACATAAGCTGGCAGGAGG + Intergenic
1121704882 14:95984038-95984060 CTGTAAGGAAAGGAGGAAGGAGG - Intergenic
1121788263 14:96679477-96679499 CTGTGAAAAAATCAGGAAGGAGG - Intergenic
1122027393 14:98887574-98887596 CTCTGAGTCAAGCAGGAAGATGG + Intergenic
1122867992 14:104617926-104617948 CTGTGGGAGAAGCAGGGAGCTGG - Intergenic
1123955409 15:25329368-25329390 CTGTGAAATGAGCATGAAGTGGG + Intergenic
1124088909 15:26579277-26579299 CTGTGAGCAGAGCTGGAAGGTGG + Intronic
1124231034 15:27946702-27946724 CTGAGAGATGGGCAGGCAGGAGG - Intronic
1124801773 15:32839778-32839800 CTGTGAGCTAAGCAGTGGGGAGG - Intronic
1125587089 15:40828604-40828626 CTGGGAGATGTGCAGGAAGCAGG + Exonic
1126070828 15:44863571-44863593 CTGTTTGTTAAGCAGGGAGGAGG + Intergenic
1126603542 15:50453007-50453029 ATATGAGATAGGCAGGAAAGTGG + Intronic
1127698553 15:61474981-61475003 CTGTGAAAGAAGCATCAAGGGGG + Intergenic
1127892691 15:63269262-63269284 CTGTGAGACCAAGAGGAAGGAGG - Intergenic
1129142358 15:73611580-73611602 CCAGGAGATAAGAAGGAAGGAGG + Intronic
1129354194 15:74978246-74978268 CTCTGAGACAGGTAGGAAGGAGG + Intronic
1129779791 15:78263131-78263153 CTGTGAGAAAGGCAGGCAAGTGG + Intergenic
1130146530 15:81278516-81278538 CAGGGAGACAAGGAGGAAGGAGG + Intronic
1130763847 15:86850388-86850410 ATGTGTGAAAAACAGGAAGGGGG - Intronic
1130792246 15:87167936-87167958 CTGAGAGTCAAGCAGGAAGCAGG - Intergenic
1131185244 15:90268340-90268362 AAGGGAGATAAGTAGGAAGGTGG - Intronic
1132092644 15:98958380-98958402 CTGGGAGAGAAGCAGGCATGGGG - Exonic
1133045659 16:3087087-3087109 CTTTGGGCTGAGCAGGAAGGAGG + Intergenic
1133257413 16:4525670-4525692 CTGGGTGATGAGCAGGAAAGAGG + Intronic
1133434519 16:5767583-5767605 GTGTGACAAAAGCAGGAAGCTGG - Intergenic
1136867922 16:33771061-33771083 ATGTGAGAGAAGAAGGAGGGCGG + Intergenic
1136938466 16:34498866-34498888 AAGTGAGAAAAGAAGGAAGGAGG - Intergenic
1136961353 16:34849691-34849713 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1137512387 16:49113056-49113078 CCATGAGATGAGAAGGAAGGCGG - Intergenic
1138100709 16:54250046-54250068 CTCTGACATAGACAGGAAGGTGG + Intronic
1138494084 16:57396648-57396670 CTGTTTGTTAAGCAGGAAGGAGG + Intergenic
1140236820 16:73166578-73166600 CTGGGAGAGAGGCAGGGAGGGGG + Intergenic
1140890954 16:79284818-79284840 CTGAGAGATGAGCAGAAAAGAGG - Intergenic
1140921579 16:79543351-79543373 GTATGAGATAAGTGGGAAGGAGG - Intergenic
1141316233 16:82964967-82964989 CTGGGAGCTAAGAAGGAAGGTGG + Intronic
1141427141 16:83951884-83951906 CAGGGAGAGAAGGAGGAAGGAGG - Intronic
1141467231 16:84214366-84214388 CTCTGAGATTTGCAGGGAGGTGG + Intergenic
1141665105 16:85461901-85461923 CTGGGAGGAGAGCAGGAAGGAGG - Intergenic
1141904085 16:87011510-87011532 CAGTGAGATCAGCAGGTTGGAGG - Intergenic
1203104255 16_KI270728v1_random:1345217-1345239 ATGTGAGAGAAGAAGGAGGGCGG - Intergenic
1203129259 16_KI270728v1_random:1617151-1617173 ATGTGAGAGAAGAAGGAGGGCGG + Intergenic
1143542809 17:7579720-7579742 CTGGCAGGTAAGGAGGAAGGAGG + Exonic
1144353526 17:14422512-14422534 CTATGGAATAGGCAGGAAGGAGG - Intergenic
1146954798 17:36931297-36931319 GTGTGTGAGAGGCAGGAAGGTGG - Intergenic
1147318982 17:39634734-39634756 CTGCCAGATATGCAGGCAGGAGG - Intronic
1148395408 17:47304230-47304252 CTGGGAGATGAGCAGGGAGGCGG - Intronic
1148837145 17:50471299-50471321 CTGTGGGCTAAGCATGAAAGGGG + Intronic
1149643446 17:58220371-58220393 CTGTGAGGCAAACTGGAAGGTGG - Intronic
1150472424 17:65448474-65448496 CTGTAAGATAAGAATGAGGGTGG + Intergenic
1151257109 17:72886441-72886463 CTCTGAGAGAAGGAGAAAGGAGG - Intronic
1151635648 17:75346026-75346048 CTGTGAGATGAACTGCAAGGAGG + Intronic
1152196938 17:78923948-78923970 CTCAGACATAAGAAGGAAGGAGG + Intronic
1152249032 17:79201994-79202016 CTGTGAGTGAAGCCGGCAGGAGG - Intronic
1152494738 17:80662958-80662980 CTGTGAGGTTAGGAGGGAGGTGG + Intronic
1154339887 18:13494015-13494037 CTGTGGGATGGCCAGGAAGGCGG - Intronic
1156507618 18:37608413-37608435 CTGTGATAAAAGTAGGAGGGAGG - Intergenic
1157370983 18:47111554-47111576 CTGTGATGTAAGCAGAAAAGAGG - Intronic
1158339945 18:56455014-56455036 CTGTGACATTAGGATGAAGGAGG + Intergenic
1159706168 18:71691603-71691625 CTGTAAGATGAGGAGCAAGGAGG - Intergenic
1161235272 19:3194712-3194734 CTGTTAGAGAAGAAGGAAAGAGG + Intronic
1161800433 19:6414484-6414506 CTGTGAGGTAGGTTGGAAGGTGG + Intronic
1161854727 19:6757555-6757577 CTGGGGGATAAGCAGGCAGGAGG - Intronic
1162934393 19:13974187-13974209 CAGTGAGTGAAGCAGGAAGGGGG + Intronic
1163199318 19:15752719-15752741 CTGTCAGAGAAGCAGAAAGAAGG - Intergenic
1163222131 19:15929333-15929355 CTGAGAGAGAAGCAGGAAGAGGG + Intronic
1163580343 19:18135059-18135081 CAGGGAGAGAAGCAGGAAGAGGG + Intronic
1163624406 19:18380636-18380658 CTGTGAGAGGACAAGGAAGGAGG + Intronic
1165044015 19:33090045-33090067 CTTGGAGAGAATCAGGAAGGAGG + Intronic
1165527935 19:36371961-36371983 AAGGGAGATAAGAAGGAAGGAGG + Intronic
1167025259 19:46911509-46911531 CTCTGAAATATGCAGAAAGGAGG + Intergenic
1167885814 19:52499061-52499083 CTCTGAGGTGAGGAGGAAGGAGG - Intronic
1168522166 19:57061009-57061031 GTGTGAGAGAAGCAGGTAAGAGG - Intergenic
925283024 2:2698036-2698058 CTCTGTAAAAAGCAGGAAGGAGG + Intergenic
926432681 2:12805372-12805394 ATGTGAGATAGGCAGAAAAGAGG - Intergenic
927787889 2:25986557-25986579 CTGAGAAATACGCAGGAAGTTGG - Intergenic
928269500 2:29843418-29843440 CTGGAAGAAAAGAAGGAAGGAGG + Intronic
928438907 2:31275118-31275140 GTGTGACATAAGCAGTGAGGAGG - Intergenic
928884310 2:36130639-36130661 CTGTGACATAAGCAGAAGAGCGG + Intergenic
929827630 2:45321728-45321750 CAGTGAGAAAAGCAGCAAGACGG + Intergenic
929897870 2:45977328-45977350 TTGTTAGAAAATCAGGAAGGAGG + Intronic
930166563 2:48209284-48209306 CTGTGATGTAAGCAGGAATTGGG + Intergenic
931706086 2:64947585-64947607 CTGTGAGATGAGCTGGACTGAGG - Intergenic
931991054 2:67790851-67790873 CTGTGAGTTAGGGAGGAAGCTGG - Intergenic
932499881 2:72174047-72174069 CTGTGAGAAAAGGGGCAAGGTGG + Intergenic
932750537 2:74368881-74368903 CTGTGAGGTGAACAGGGAGGAGG + Intronic
934299329 2:91767856-91767878 CTGGGAGCTAAGGAAGAAGGGGG - Intergenic
934600725 2:95655950-95655972 CTGTGAGAAAGGAAGGAATGGGG - Intergenic
935411636 2:102770585-102770607 CTGTGAGAAGAGAAGAAAGGAGG - Intronic
936941866 2:117891726-117891748 ATATGATATAAACAGGAAGGGGG - Intergenic
937515974 2:122655893-122655915 CTGTGAGGTTAGAAGCAAGGTGG - Intergenic
937547094 2:123036056-123036078 CTGTGAGAGCAGCCAGAAGGGGG - Intergenic
938187552 2:129245210-129245232 CAGAGAGATGAGCAGGAAGAGGG - Intergenic
938273681 2:129997307-129997329 ATGTGAGAAAGGAAGGAAGGGGG + Intergenic
938738553 2:134208985-134209007 CTGTTACATCAGCATGAAGGAGG + Intronic
938754755 2:134369359-134369381 TTGTGAGATTAGCAGGGAGATGG + Intronic
940494105 2:154403572-154403594 CTGAGAGATAAGCAGTGTGGAGG - Intronic
941342024 2:164318398-164318420 GTGTGAGGTAAGCAGGAGGCAGG - Intergenic
942384745 2:175430495-175430517 TTGTGAGACAGGGAGGAAGGGGG + Intergenic
943087694 2:183332960-183332982 CTGCGAAATAATCAGGATGGTGG - Intergenic
944531541 2:200672814-200672836 CTGTGAGCTAAGCAGGTATCTGG + Intronic
944667059 2:201967431-201967453 CTGCGAAACAAGCAGGAAAGAGG - Intergenic
944682819 2:202092306-202092328 CTCTGAGATGTGCAGGAAGAGGG - Intronic
945324996 2:208471830-208471852 TTGTGAAAGAAGCAGGAGGGGGG + Intronic
945489355 2:210436458-210436480 CTGATAGATAAGAAGGAAAGAGG + Intronic
946241272 2:218357417-218357439 CTGTGGGATGAGGAGGCAGGTGG + Intronic
946326767 2:218988658-218988680 CTGTGAGACAGGCAGGACAGTGG + Intergenic
948398951 2:237668531-237668553 ATGGGAGAGAGGCAGGAAGGAGG - Intronic
1169045733 20:2533210-2533232 CTGTGAGATGAGCCAGAAGCTGG - Intergenic
1170444440 20:16411426-16411448 CTGTTAGAGAAACAGGATGGTGG - Intronic
1170455771 20:16531468-16531490 CTGTGAGAAAACCAGGTACGAGG + Intronic
1171149594 20:22815519-22815541 CTTTGAGATAAGCATGCACGTGG + Intergenic
1171308235 20:24124246-24124268 CTGTGAGATAAGAAGAGAGATGG + Intergenic
1171311823 20:24150881-24150903 ATGTGAGAGAAGCAGGAAGCAGG + Intergenic
1172045588 20:32077825-32077847 CTGTGGTATAAAAAGGAAGGAGG - Intronic
1172847505 20:37938603-37938625 CTGTGGGGCAAGCAGGGAGGAGG + Intronic
1173141119 20:40483905-40483927 CTCTGAGAGAAGCAGAAAGAAGG - Intergenic
1173938718 20:46891819-46891841 CTGAGAGATAAGCAGGAGGCAGG - Intergenic
1174290893 20:49507786-49507808 CTGGGAGAAAAGCAGGGAAGTGG + Exonic
1174974313 20:55314501-55314523 CAATGAGTTAAGAAGGAAGGAGG - Intergenic
1175524989 20:59627503-59627525 CATTGAGATGAGCAGGATGGGGG + Intronic
1175906429 20:62381797-62381819 CTGTGAGGTGAGCCTGAAGGAGG + Intergenic
1176933231 21:14838909-14838931 CTGTAAGACCAGAAGGAAGGTGG + Intergenic
1177004044 21:15648725-15648747 CAGTGAGAAAAGGAGGAAGAGGG - Intergenic
1178186465 21:30227689-30227711 CTGTGGGAAAATCAGGATGGGGG - Intergenic
1178233308 21:30812538-30812560 CTGTGTGATAAGCAGGTAAGAGG - Intergenic
1178288612 21:31347094-31347116 CTGAGAGATAGGGAAGAAGGTGG - Intronic
1179354890 21:40649986-40650008 CTGTGAGATGAGCAGCACAGAGG + Intronic
1179768209 21:43590843-43590865 CAGGGAGAGGAGCAGGAAGGAGG + Intronic
1181030463 22:20146980-20147002 GTGAGAGAGAAGCAGAAAGGTGG - Intronic
1181675800 22:24450887-24450909 CTGAGAGATATGGAGGAAGGTGG + Intergenic
1181746648 22:24959697-24959719 CTGTACGAGAAGAAGGAAGGGGG + Intronic
1182676562 22:32043657-32043679 CTGTGAGCAGAGAAGGAAGGTGG + Intronic
1183716083 22:39534469-39534491 CTATGTTAGAAGCAGGAAGGAGG - Intergenic
1184066909 22:42126416-42126438 CGGTGGGGTAAGCAGGAATGAGG + Intergenic
1184069636 22:42140120-42140142 CGGTGGGGTAAGCAGGAATGAGG + Intergenic
1184651883 22:45923138-45923160 CTGTTTGATGCGCAGGAAGGTGG + Exonic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1184765826 22:46571965-46571987 CTGGGTGATAAGCAGGTGGGAGG - Intergenic
949372855 3:3354294-3354316 CTGTGCCATAAGCAGGGAGCAGG - Intergenic
949868006 3:8562592-8562614 CTGTGAGATAAATAGGAATGTGG + Intronic
950939779 3:16882119-16882141 CAGAGAGACAAGCAGGAATGAGG + Intronic
953731297 3:45450789-45450811 CTGTGTGAAAAACAGTAAGGTGG - Intronic
955509154 3:59662100-59662122 ATGTGTGATGAGCAGGAGGGAGG + Intergenic
955906895 3:63816692-63816714 GTGTGTGATAAGCTGGAGGGAGG - Intergenic
956335293 3:68156293-68156315 CTGGGAAATAAGAAGGAATGAGG + Intronic
956994752 3:74812398-74812420 CTGAGGGATAAGAAGGAAGCTGG - Intergenic
957374358 3:79336793-79336815 CTGTGAAAGCAGCTGGAAGGGGG + Intronic
957457698 3:80473134-80473156 CTGTGAAAGAAGCTGGGAGGAGG + Intergenic
958505291 3:94968963-94968985 ATGGGAGATAAAAAGGAAGGGGG - Intergenic
958829182 3:99067046-99067068 CTGTAAGATAAGCAATATGGTGG - Intergenic
961390619 3:126550492-126550514 CTGGGAGATGGGCTGGAAGGAGG - Intronic
961489111 3:127240236-127240258 CTGTGAAATAAGAGGTAAGGTGG - Intergenic
961797882 3:129422805-129422827 CTGTGAGACAAAAAGGAATGGGG - Intronic
964676694 3:159290290-159290312 ATGTAAGAACAGCAGGAAGGGGG + Intronic
966063754 3:175791330-175791352 CTGTGAGCTTAGCTGGAAGCAGG + Intronic
966769472 3:183491453-183491475 CTCTGAGATAGGCAGCATGGTGG + Exonic
969139430 4:5055675-5055697 ATGTCAGACGAGCAGGAAGGAGG - Intronic
969660206 4:8523010-8523032 CTGTGATAAAAGCAGGAGGTGGG - Intergenic
970277526 4:14417832-14417854 CTCTGAGATAAGCATCATGGTGG - Intergenic
970380363 4:15501317-15501339 GTGTGAGATAGGAAGGAAAGGGG - Intronic
970736489 4:19175578-19175600 CTGTGACATAAACAAGAATGAGG - Intergenic
971850459 4:31979211-31979233 CAGTGAGATAAGTGGGAAGGAGG + Intergenic
972582603 4:40407806-40407828 CAGTCAGAGAAGCAGGAGGGTGG - Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
976531486 4:86158362-86158384 CTGTAAGATCAGCAAGAAAGTGG + Intronic
976564123 4:86533926-86533948 CTGTGAGATAAACAGGAAAATGG - Intronic
976935098 4:90621349-90621371 TTTTGAAAGAAGCAGGAAGGAGG + Intronic
977348817 4:95853441-95853463 CTGAGAGACAAGAGGGAAGGAGG + Intergenic
977917806 4:102613402-102613424 CTGTGAGAAAGAAAGGAAGGAGG - Intronic
978807786 4:112818588-112818610 CTGTATGATAAGCAGGGAGAGGG + Intronic
979699970 4:123656443-123656465 CTGTGAAAGCAGCTGGAAGGAGG - Intergenic
981011426 4:139929082-139929104 CTAGGAGATAAGCAAGACGGTGG + Intronic
983103114 4:163650816-163650838 CTCTGAGATTAGCAGGAAATAGG - Intronic
984617250 4:181912847-181912869 TTGAGAGATAAGGAGAAAGGTGG + Intergenic
985131056 4:186739051-186739073 AGGAGAGATACGCAGGAAGGGGG + Intergenic
985150610 4:186943543-186943565 CAGTGAGAAATGCAGGAACGTGG + Intergenic
985336270 4:188898887-188898909 CTGTGAGACTAGCAGGTAAGAGG - Intergenic
985377821 4:189360567-189360589 CAGTGAGATAAGAAGGAAACAGG + Intergenic
989741717 5:44781261-44781283 TTGTGAGATAAGAAAGAGGGAGG - Intergenic
990454434 5:55971376-55971398 ATGTAAGATAAACTGGAAGGAGG - Intronic
992149459 5:73888463-73888485 CTGAGAAATAAGTGGGAAGGTGG + Intronic
992417362 5:76564828-76564850 CTGGGAGAGGAGCAGGAAGGAGG + Intronic
993057676 5:83001181-83001203 CTTTGAGACAGGCAGGTAGGAGG - Intergenic
995100026 5:108289400-108289422 GTGTGAGATCAGCACAAAGGAGG - Intronic
995707154 5:114997959-114997981 CTGTTTGTTAAGCAGGGAGGAGG - Intergenic
996019917 5:118579631-118579653 CTGCGAGACAAGGAAGAAGGGGG - Intergenic
997000137 5:129749619-129749641 CTGTGATATAAACAATAAGGAGG - Intronic
997073035 5:130640605-130640627 CTGTTTGTTAAGCAGGGAGGAGG - Intergenic
997420644 5:133764203-133764225 CTGGGAGCTGGGCAGGAAGGAGG - Intergenic
998575856 5:143315891-143315913 CTGTTAGGTAAGCAGGCAGTTGG - Intronic
998713130 5:144849222-144849244 CTGTTTGTTAAGCAGGGAGGAGG + Intergenic
1001426734 5:171627858-171627880 AGGTCACATAAGCAGGAAGGGGG + Intergenic
1002898467 6:1392506-1392528 CTGGGAGAGGAGCAGGCAGGCGG - Intronic
1003134450 6:3423566-3423588 CTGTAAGTTAAAAAGGAAGGAGG + Intronic
1003690258 6:8346709-8346731 CTGTGAAAGCAGCTGGAAGGGGG + Intergenic
1004096420 6:12559482-12559504 CTATGAGATAAGCAGGAAAAAGG + Intergenic
1004232691 6:13847303-13847325 CTGTGAGATTAGAAGCAAGATGG - Intergenic
1004317306 6:14600987-14601009 CTTTGAGTGTAGCAGGAAGGTGG + Intergenic
1004532063 6:16462894-16462916 CTGTTTGTTAAGCAGGGAGGAGG - Intronic
1004785671 6:18964962-18964984 ATGTGAGATGACCAGTAAGGAGG + Intergenic
1006035096 6:31205151-31205173 CTGTGAGCTAAGCCGGACGATGG - Intergenic
1007595653 6:43049759-43049781 CTGTGAGAGGATCAGGATGGAGG - Intronic
1008087754 6:47262325-47262347 GACTAAGATAAGCAGGAAGGAGG - Intronic
1008830981 6:55761536-55761558 CTGTGAGTGAAACAGCAAGGAGG - Intronic
1009315344 6:62212382-62212404 ATGAGAGATAAGGAGGAAAGGGG + Intronic
1009385235 6:63079159-63079181 CTGTTTGTTAAGCAGGGAGGAGG + Intergenic
1010653408 6:78481367-78481389 CTGAGAGAGAAGCAGAAAGGAGG - Intergenic
1011022859 6:82833646-82833668 CTGTGAGACTAGCAGCAAGATGG + Intergenic
1011589619 6:88959424-88959446 CTGAGAGAGAAGCAGGTTGGAGG - Intronic
1013907117 6:115233506-115233528 CTGTTTGTTAAGCAGGGAGGAGG + Intergenic
1015154275 6:130074563-130074585 CAGGCAGATAATCAGGAAGGAGG - Intronic
1016822841 6:148362414-148362436 CTATGAGATAAGCAGTGATGTGG + Intronic
1016915665 6:149242109-149242131 ATGTGGGATAGGCAGGAAGGAGG - Intronic
1018037375 6:159893123-159893145 CTTTGAGTTTTGCAGGAAGGTGG + Intergenic
1018680868 6:166263677-166263699 CTCTGAGATAAGGAGGGATGAGG - Intergenic
1019657650 7:2205053-2205075 CTGTGAGGTTAGAAGCAAGGTGG - Intronic
1019868717 7:3737728-3737750 CTGTGAGACAAGACAGAAGGAGG + Intronic
1019908944 7:4086621-4086643 CAGAGAGATGAGAAGGAAGGAGG - Intronic
1019937511 7:4266073-4266095 CTGTCAGGTGAGAAGGAAGGGGG - Exonic
1021173664 7:17424957-17424979 CCATGAGCTAGGCAGGAAGGAGG - Intergenic
1021791615 7:24211689-24211711 ATGTGACGTAAGCAGGAAAGAGG + Intergenic
1022009632 7:26297625-26297647 ATGTGAGGAAAGAAGGAAGGAGG - Intronic
1022322856 7:29303475-29303497 CTGGGAAATAAGAGGGAAGGGGG - Intronic
1022588058 7:31634647-31634669 CTATGGGATAGGCAGGATGGGGG + Intronic
1022819858 7:33948868-33948890 CTGTGAGATAAGCAGGAAGGAGG + Intronic
1022835443 7:34109259-34109281 CTGGGAGGTAGGCAGTAAGGAGG + Intronic
1023120393 7:36903082-36903104 CTGTGAGATGGGCAGGTAGACGG - Intronic
1023438173 7:40159709-40159731 CTGAGAGATAGGAAGGCAGGAGG + Intronic
1023545138 7:41310678-41310700 CTGTATGAGAAGCAGGGAGGAGG + Intergenic
1023675465 7:42624682-42624704 CTGTGAGCTAAGCAGCCATGTGG - Intergenic
1023990416 7:45125322-45125344 CCATGAGATCAGCAGAAAGGAGG - Intergenic
1024073729 7:45808028-45808050 CTGGGAGACAGGCAGGAATGTGG - Intergenic
1024944935 7:54799038-54799060 AAGTGAGATGAGGAGGAAGGAGG + Intergenic
1025798134 7:64758853-64758875 CTGTTTGTTAAGCAGGGAGGAGG + Intergenic
1026436249 7:70401424-70401446 TGGTGAGATTAGGAGGAAGGAGG + Intronic
1027431063 7:78113114-78113136 GTGTGAGATGAGCTGGGAGGGGG + Intronic
1027791764 7:82644116-82644138 CTGTTTGTTAAGCAGGGAGGAGG - Intergenic
1028494517 7:91448702-91448724 CTGTTTGTTAAGCAGGGAGGAGG + Intergenic
1030447725 7:109668292-109668314 TGGTGAGAAAAGCAGGATGGTGG + Intergenic
1030523129 7:110622588-110622610 CTAAGAGAGAAGAAGGAAGGAGG + Intergenic
1031267210 7:119596209-119596231 CTGTAAGAGAAGCATGATGGTGG + Intergenic
1031981662 7:128130913-128130935 CAGGGAGAAAAGGAGGAAGGAGG - Intergenic
1033200594 7:139365578-139365600 CTGTGAGTTCAGCAAGCAGGAGG + Intronic
1034551679 7:151824631-151824653 CTGTGAGAGGAGCAGGAGAGAGG - Intronic
1035358194 7:158292112-158292134 TTCTGAAAGAAGCAGGAAGGTGG - Intronic
1037794166 8:21977658-21977680 CTGTAAGATAAGTAGGCAGAAGG + Intronic
1037916047 8:22774056-22774078 CTGTGAAACCAGCAGGAGGGAGG - Intronic
1038474242 8:27852826-27852848 CTGAGTGTTAAGCAGGAAGCAGG - Intergenic
1038709943 8:29934028-29934050 AAGTGAGACAAGCAGGAAGGAGG - Intergenic
1039382511 8:37099541-37099563 TGGTGAGAGAGGCAGGAAGGAGG - Intergenic
1039692462 8:39877820-39877842 CTGTTCGTTAAGCAGGGAGGAGG + Intergenic
1039984515 8:42436426-42436448 ATGTGAGAGAAGAAGGAAAGAGG - Intronic
1040649655 8:49433789-49433811 CTGTTTGTTAAGCAGGGAGGAGG - Intergenic
1041002644 8:53467231-53467253 CTTTTTGTTAAGCAGGAAGGAGG - Intergenic
1041121729 8:54592818-54592840 CTGTGTTCTAGGCAGGAAGGGGG + Intergenic
1041213054 8:55572065-55572087 CTGTGAGCAAACAAGGAAGGGGG - Intergenic
1041370480 8:57154610-57154632 CAGTGGGATAAGGAGGGAGGGGG - Intergenic
1041691395 8:60691486-60691508 CAGTGAGAAAAGGAGGATGGGGG - Intronic
1041718993 8:60959497-60959519 GGGTGAGAGAAGAAGGAAGGTGG - Intergenic
1042920165 8:73912383-73912405 CTGTTTGTTAAGCAGGGAGGTGG - Intergenic
1043886760 8:85609890-85609912 GTTGGAGATAAGCAGGAGGGCGG - Intergenic
1044724763 8:95184418-95184440 CGGGGAGATGGGCAGGAAGGGGG + Intergenic
1045314984 8:101035806-101035828 CTGGGAGATTAGAAGGCAGGAGG - Intergenic
1046102291 8:109629045-109629067 CTCTGAGATAGGCAGGAATATGG + Intronic
1046502471 8:115096410-115096432 CTGTAGGATAAACAGGAAGATGG + Intergenic
1047346264 8:124031700-124031722 CTGAGAGATAAGAGGGCAGGAGG + Intronic
1048770188 8:137886728-137886750 CTGGGGGACAAGCAGGAAAGAGG + Intergenic
1048925383 8:139266630-139266652 ATGTGTGAGAAGCAGGAAAGTGG + Intergenic
1049270559 8:141693439-141693461 CTGAGGGATGGGCAGGAAGGAGG + Intergenic
1049341431 8:142114646-142114668 CTTTGAGAGAAGAAGGAAGAAGG + Intergenic
1049697033 8:143989258-143989280 TTGGGAGCTAAGCAGGGAGGTGG + Intronic
1049726526 8:144148876-144148898 CAGTGAGGTAAGCAGAAAAGGGG + Intronic
1050953205 9:11623699-11623721 ATGGGAAAGAAGCAGGAAGGAGG + Intergenic
1052839948 9:33284314-33284336 CTGAGAGTTTAGCAGGAATGGGG + Intergenic
1052998869 9:34566306-34566328 CTGTCAGAGAAGAAGGAAGCAGG + Intronic
1053368122 9:37538152-37538174 CTTTGAGATTAGAAGGATGGAGG - Intronic
1053946356 9:43312877-43312899 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1054770442 9:69078435-69078457 CTGAGAGAAAAGGAGGAAGGTGG - Intronic
1056040252 9:82658489-82658511 CTGAGAGAAAAGAAGGAAGGTGG + Intergenic
1056716818 9:89038124-89038146 AGGAGAGATGAGCAGGAAGGAGG - Exonic
1057066888 9:92061539-92061561 CTGTTAGATTATCAGGAAGGAGG + Intronic
1057436950 9:95049124-95049146 CTGTGAAATCAGCAGAAAAGTGG + Intronic
1057748483 9:97771319-97771341 CTGACAGTTAAGCAGGAAGCAGG + Intergenic
1058473143 9:105301842-105301864 CTGTAAGAGAAGCAGGCAGCTGG - Intronic
1203589486 Un_KI270747v1:41435-41457 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1185505091 X:627440-627462 CTGTGGGATGAGCACGGAGGCGG - Intronic
1185552876 X:998002-998024 CTGTGAGCTCAGCAGGCTGGTGG - Intergenic
1185556923 X:1028895-1028917 CTGTGAGGTAGGTAGGAAGGTGG + Intergenic
1189140733 X:38602960-38602982 CTGTGTGATAAGCAAAAAAGTGG + Intronic
1190070723 X:47277080-47277102 GAGTGAGAAAAGCAGGAAGAAGG + Intergenic
1192913028 X:75625189-75625211 CTGAGAGATAAGAATGTAGGAGG - Intergenic
1196903136 X:120406335-120406357 CCGTGAGTTAAAGAGGAAGGGGG - Intergenic
1197711903 X:129677817-129677839 CTCTGAGAAAAGCACAAAGGTGG - Intergenic
1198269472 X:135041701-135041723 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1199683393 X:150242979-150243001 CTGGGAGACAGGCAGGAGGGAGG + Intergenic
1199690195 X:150303834-150303856 CTGCCAGGCAAGCAGGAAGGAGG - Intergenic
1200149394 X:153943865-153943887 CTGGGAGATGGGCAGGAAGGGGG + Intronic
1200959923 Y:8987182-8987204 CTGTTTGTTAAGCAGGGAGGAGG - Intergenic
1201076716 Y:10195242-10195264 CTGAGGGATAAGCTGGAGGGGGG - Intergenic
1201455848 Y:14166177-14166199 CTGTTTGTTAAGCAGGGAGGAGG - Intergenic
1201631909 Y:16078880-16078902 CTGTTTGTTAAGCAGGGAGGAGG - Intergenic
1201941685 Y:19466977-19466999 CCTTGAGAAAAGCAGGTAGGTGG + Intergenic