ID: 1022822326

View in Genome Browser
Species Human (GRCh38)
Location 7:33973838-33973860
Sequence ACCCCATGTCACACAGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022822326_1022822330 21 Left 1022822326 7:33973838-33973860 CCATGGCCTGTGTGACATGGGGT 0: 1
1: 0
2: 3
3: 14
4: 190
Right 1022822330 7:33973882-33973904 TGCCATTTATGACCTCTCTTTGG No data
1022822326_1022822332 28 Left 1022822326 7:33973838-33973860 CCATGGCCTGTGTGACATGGGGT 0: 1
1: 0
2: 3
3: 14
4: 190
Right 1022822332 7:33973889-33973911 TATGACCTCTCTTTGGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022822326 Original CRISPR ACCCCATGTCACACAGGCCA TGG (reversed) Intronic
900404484 1:2486425-2486447 ACCCCAGGCATCACAGGCCAAGG - Intronic
901460168 1:9386556-9386578 CCCCCATGTCACAGAGAGCAGGG + Intergenic
901510239 1:9714795-9714817 ACCCCAGGGCACACACTCCATGG + Intronic
903002784 1:20278134-20278156 TGCCCATGTTACACAGGCCATGG + Intergenic
903467465 1:23561871-23561893 GCCTTATGTCACACAGCCCATGG - Intergenic
903615810 1:24655378-24655400 ACCCCAACTCAAACAGCCCACGG - Intronic
904296341 1:29521927-29521949 GCCCCACGTCACACAGCTCATGG - Intergenic
904422667 1:30404300-30404322 ACCCCACAGCACACAGGGCAGGG + Intergenic
904433371 1:30479277-30479299 ACCCTCAGTCACACAAGCCATGG + Intergenic
904558063 1:31378369-31378391 ACCCCCTGTCCCCCAGGGCAGGG - Intergenic
904577656 1:31515408-31515430 ACGCAATGTCACTCAGGCCCTGG - Intergenic
907341846 1:53740697-53740719 TGCCCATAACACACAGGCCAAGG + Intergenic
907425099 1:54374578-54374600 TCCCCATTTCACAGAAGCCAAGG + Intronic
909716809 1:78718077-78718099 ACACTATGTCAAACAGGCCAGGG + Intergenic
910085943 1:83402546-83402568 ACACCACGTCACACCTGCCAGGG + Intergenic
911242715 1:95483194-95483216 AGCCCATGTCACTGCGGCCAAGG + Intergenic
911649900 1:100376135-100376157 ACCCCATGACAGGCAGGCCCTGG - Intronic
912491229 1:110063922-110063944 CCCCCATGTAAAACTGGCCACGG + Intronic
913001511 1:114585109-114585131 AGCCCAGGTCAAACAGCCCATGG + Exonic
915204960 1:154263255-154263277 TCCCCAAGCCACGCAGGCCATGG - Intronic
915213884 1:154327887-154327909 CCCCCATGTCACCCAAGGCAGGG + Intronic
915483575 1:156204295-156204317 ACTCCATGTCAGACAGGGCACGG - Intronic
918209025 1:182334419-182334441 ATCCCATGTCACACACCTCAGGG + Intergenic
919485768 1:198145495-198145517 CCCCCATGTCACAAAGGTGAAGG + Intergenic
923561511 1:235045532-235045554 TCCCCTTCTCACACAGCCCAAGG - Intergenic
924248505 1:242108072-242108094 ACCCCAGCCCACACAGCCCAAGG - Intronic
924748284 1:246859432-246859454 CTCCCATGTCACACAGAGCATGG - Intronic
1066229968 10:33422644-33422666 ACCCCATTACAAAGAGGCCACGG - Intergenic
1067060051 10:43073649-43073671 CCACCATGTCACACTGCCCATGG + Intergenic
1069910495 10:71755825-71755847 ACCCCATGCCACAGAGCTCAAGG + Intronic
1070149944 10:73799429-73799451 ACCCCATGCCTCACATGCCCCGG + Exonic
1074077953 10:110146452-110146474 ACTCCCTGTCACCCAGGCTAGGG + Intergenic
1076438746 10:130464646-130464668 AACCCACGCCACACAGGCCTGGG + Intergenic
1078012145 11:7580577-7580599 ATCCCATCCCACACAGGCCCTGG - Intronic
1081734835 11:45395379-45395401 ACCACATCTCCCTCAGGCCAAGG - Intergenic
1084040328 11:66539112-66539134 CCCCCAACTCACCCAGGCCAGGG + Exonic
1084271929 11:68033553-68033575 ACCCCATGGCTCAGAGGCCCAGG - Intronic
1084388185 11:68857337-68857359 ACCATGTGTCATACAGGCCAGGG - Intergenic
1084939808 11:72606520-72606542 ACCCCATGCCACACCCACCACGG - Intronic
1087266011 11:96062167-96062189 ACTCCATGTAACACAAACCAAGG - Intronic
1088596060 11:111441073-111441095 GCACAAGGTCACACAGGCCAGGG + Intronic
1090237301 11:125158769-125158791 ACCCCATGTAACCCTGGGCAGGG + Intergenic
1090364412 11:126193547-126193569 AGTCCATGTCAGACAGGCCGTGG + Intergenic
1091141203 11:133236423-133236445 ATCCCAAGTCACAGAAGCCATGG + Intronic
1091518169 12:1208252-1208274 AACCCATGGCCCACAGCCCATGG + Intronic
1092409276 12:8241812-8241834 GCCCAAGGTCACACAGGGCAAGG + Intergenic
1092590180 12:9946068-9946090 ACCCCATTCCTAACAGGCCATGG - Intergenic
1092935727 12:13362402-13362424 ACCACTTGTGACACAGGCAATGG - Intergenic
1095270120 12:40208693-40208715 ACCCAGTGTTACACAGGCCCAGG - Intronic
1095444558 12:42271123-42271145 ACCCTATGAAACAAAGGCCACGG + Intronic
1096793595 12:54060433-54060455 TCCCCTTCTCACAGAGGCCAGGG + Intergenic
1097381565 12:58901626-58901648 ACCCCATGTCATACAAGAAATGG + Intronic
1098122519 12:67256826-67256848 ATCCCCTGTCAGACAGGGCATGG + Intergenic
1103927383 12:124430455-124430477 GCTCCACGTGACACAGGCCAGGG + Intronic
1104229753 12:126873032-126873054 ACCCCATGAAACACAGGCCCAGG - Intergenic
1107472877 13:40706894-40706916 ACCCCATCCCCCACAGGCCCTGG + Intergenic
1108829665 13:54461623-54461645 TCCCAGTGTCACAAAGGCCAAGG - Intergenic
1112581764 13:100682333-100682355 ACCCCATGACCCACAAGTCATGG - Intergenic
1113422594 13:110182051-110182073 ACTCCATGTCACATGGGTCACGG + Intronic
1114629026 14:24147553-24147575 GCCCCAGGTCACTCAGACCACGG - Exonic
1119083821 14:71721760-71721782 ACCCCATGTGACACCAGCCATGG - Intronic
1121520130 14:94580611-94580633 ACACCATGTCCCCCAGGCAAGGG + Intronic
1122930368 14:104930665-104930687 ACCCCACTCCACCCAGGCCAGGG - Intronic
1125450013 15:39798384-39798406 TTCCCATGCCCCACAGGCCAAGG + Intergenic
1126192635 15:45894673-45894695 ACCACATTTCACACACGCCTGGG - Intergenic
1129889316 15:79060564-79060586 ACCCAATGTCACACAGGACATGG - Intronic
1130183028 15:81651181-81651203 ACCCCAAGTCAGAAAGGGCAGGG - Intergenic
1132777860 16:1605833-1605855 ACGCCATGTCACAAGGACCAGGG - Intronic
1133632360 16:7633066-7633088 AAGCCTTGTAACACAGGCCATGG - Intronic
1135096753 16:19570917-19570939 ACCCCACTTCACACCGGCCCGGG - Intronic
1137713053 16:50580301-50580323 ACCCCTTCCCACACATGCCAGGG + Intronic
1142307661 16:89294609-89294631 CCCCCATGTGCCACAGCCCATGG + Intronic
1142473956 17:179251-179273 ACCGCATGTATCTCAGGCCAGGG + Intronic
1142607783 17:1091505-1091527 ACCCCATAACACACAGGCCCAGG + Intronic
1143509222 17:7386373-7386395 ATCCCATGACAAACAGGTCAGGG - Intronic
1144141214 17:12350321-12350343 ACCCCAGTTCACACAGGAAATGG + Intergenic
1144644516 17:16963042-16963064 GCCCCATGACTCACAGCCCAGGG - Intronic
1148047113 17:44750940-44750962 ACCCCATGTCACAAAAGGAAAGG - Exonic
1152615405 17:81335686-81335708 ACCCCATGTCCCTGTGGCCAAGG + Intergenic
1152747855 17:82049511-82049533 ACCCTGTGTCCAACAGGCCAAGG + Intronic
1155169380 18:23256006-23256028 ACCCCATGTAAGGAAGGCCAAGG - Intronic
1155169805 18:23259147-23259169 ACCCCATGTGAGGAAGGCCAAGG - Exonic
1157426358 18:47587714-47587736 GCCCAAAGTCACACAGCCCAGGG + Intergenic
1157549769 18:48573370-48573392 CCTCCATGTGACCCAGGCCAGGG + Intronic
1157903233 18:51541215-51541237 ACCCCAGGTCACACAGCAAATGG - Intergenic
1160622607 18:80181341-80181363 TCCCGATGCCACACACGCCAAGG + Intronic
1160889070 19:1367567-1367589 ACCCCATGTCACGGTGGCCTCGG + Intronic
1161566433 19:5005372-5005394 ACGACAGGTCACAGAGGCCATGG - Intronic
1161970906 19:7579533-7579555 AACCCATGTCTCACATTCCATGG + Intergenic
1162228942 19:9248923-9248945 ACCCCTTGTCACACAGATCAGGG - Intergenic
1162231107 19:9267826-9267848 ACCCCGTGTCACAGAGTTCAGGG + Intergenic
1163158431 19:15451258-15451280 TCCTCATGTCACGGAGGCCATGG - Intergenic
1163242772 19:16074649-16074671 TCCCCAGGTCACACAGCACAGGG - Intronic
1164502098 19:28828727-28828749 AGCCCACGGCACCCAGGCCATGG + Intergenic
1164572213 19:29382676-29382698 GCCCCAGGTCACAGAGGGCAAGG - Intergenic
1166740876 19:45114172-45114194 ACCCCAGTTGACACAGGCAATGG - Intronic
1166822653 19:45590082-45590104 GCCCCTGGTCATACAGGCCAGGG - Exonic
1167552435 19:50170180-50170202 GCCCAATGTCACACAGAACATGG - Intergenic
1168099022 19:54131203-54131225 TCCCCATGGCACTCAGGCCTTGG - Intronic
925130961 2:1493727-1493749 AGCCCATCTCACTCATGCCATGG - Intronic
925618731 2:5769228-5769250 TCCCCATGTCCCCCAGGCCCTGG - Intergenic
925929015 2:8692968-8692990 ATGCCAGCTCACACAGGCCAAGG + Intergenic
928133522 2:28670794-28670816 ATCTCATGTCACAAAAGCCAGGG + Intergenic
929780874 2:44956019-44956041 ACTCCAAATCCCACAGGCCAGGG - Intergenic
929917779 2:46150622-46150644 CTCCCATCTCACACAGTCCAGGG - Intronic
929923178 2:46188241-46188263 ACCTCAAGGCAGACAGGCCAAGG - Intergenic
930564766 2:53005138-53005160 ACTCCATCTCAAAAAGGCCAGGG - Intergenic
930690719 2:54360922-54360944 ACCCAAGGTCACACAGCTCAAGG - Exonic
931097466 2:58957394-58957416 ACCTCATGTCTCAGAGGCTAAGG - Intergenic
931528604 2:63186595-63186617 AAACCATGCCACCCAGGCCATGG - Intronic
931642714 2:64395935-64395957 ACCCAAAGTCACACAGGTGAGGG + Intergenic
932672230 2:73748286-73748308 AACCCATTTCACTCAGGCAAAGG + Intergenic
936959488 2:118058126-118058148 TCCCCATCTCACAGAGCCCAGGG - Intergenic
937251845 2:120528843-120528865 ACCCAAGGTCACACAGGCCTTGG + Intergenic
938260292 2:129891102-129891124 CCCCCATGTCTCACAGGCAGGGG - Intergenic
940139115 2:150474010-150474032 ACCCCACAGCACACAGGCCAGGG + Intronic
941697805 2:168572065-168572087 ACACCATGACACACAGGCCAAGG + Intronic
942274791 2:174312845-174312867 ACCATATGACCCACAGGCCAGGG + Intergenic
945402923 2:209409063-209409085 AAAAAATGTCACACAGGCCAAGG + Intergenic
947563176 2:231175940-231175962 ATCCCATGTCACCCAGGCGGGGG + Intergenic
948690073 2:239696440-239696462 TTCCCATGTCACCCAGGCAATGG - Intergenic
1171445012 20:25196639-25196661 ATCCCACGTCACACAGGATACGG + Intronic
1171458783 20:25286844-25286866 ACCCCAGGTCACAGTGGGCAGGG - Intronic
1172019636 20:31904938-31904960 AAGCCATGTCACACAGTGCAAGG - Intronic
1172240162 20:33407921-33407943 ACCCCAGGACCCAAAGGCCAAGG + Intergenic
1173286037 20:41672207-41672229 ACCCCACGTCACAGAGCCCTGGG + Intergenic
1173542871 20:43867790-43867812 ACCCCATGGTAAACTGGCCATGG - Intergenic
1173898181 20:46566605-46566627 ACTCTATCTCATACAGGCCAGGG + Intronic
1174079894 20:47963180-47963202 ATCTCATGTAAAACAGGCCATGG + Intergenic
1175232373 20:57482036-57482058 AAGCCCTGTAACACAGGCCAGGG + Intergenic
1175503325 20:59465512-59465534 GCCCCATCTGACACAGCCCAGGG + Intergenic
1175546138 20:59778976-59778998 ACCCCATGTAACACATTGCACGG - Intronic
1175966245 20:62661522-62661544 ACCCCGGGACACACAGGCCACGG - Intronic
1175994721 20:62806969-62806991 ACCCCACGCCTCACTGGCCACGG - Intronic
1178925153 21:36768583-36768605 ACCTCAGGACACACAGGGCAGGG + Intronic
1179612533 21:42561792-42561814 ACCCCATGTGACAGTGGCCGAGG + Intronic
1180027893 21:45178716-45178738 AACCCATGCCACACAGTCCCAGG - Intronic
1180107546 21:45629964-45629986 GCCCCATGGCACCCAGGCCTCGG + Intergenic
1180150773 21:45946122-45946144 ATCCGAGGTCACACGGGCCAAGG - Intergenic
1181375920 22:22457896-22457918 ACCCCATGTCTCTCACGACAAGG + Intergenic
1181541555 22:23575739-23575761 CCCCCATCTCTCCCAGGCCATGG + Intronic
1183727448 22:39597561-39597583 ACCCCATGTGGTGCAGGCCAGGG + Intronic
1185075977 22:48682472-48682494 ACCCCACGTCCCACAGGACCAGG + Intronic
1185292924 22:50036132-50036154 ACCCCAGGGCACACCTGCCAGGG + Intronic
1185414184 22:50700809-50700831 TCCCCAGGTCACACACACCATGG - Intergenic
951652229 3:24963224-24963246 ACCCCATTTCAAACAGCCAAGGG - Intergenic
952707916 3:36399011-36399033 ACCCCATGTGGGTCAGGCCAAGG - Intronic
954321370 3:49834080-49834102 ATCCCATGCCACGCAGGCAATGG - Intronic
961357153 3:126346379-126346401 AGGCCAAGTCACACAGCCCAGGG + Intronic
965073641 3:163948548-163948570 ACTCCATCTCACAGAGGGCAGGG - Intergenic
966731444 3:183154639-183154661 ACCACACCTCACACAGGCAAAGG - Intronic
968014785 3:195319528-195319550 ACTCCATGTCTCACATTCCAGGG - Intronic
969485837 4:7472021-7472043 ACCCCATCTCAGAGAGGTCAGGG - Intronic
969575171 4:8032501-8032523 GCCCCATGTCACAAGGGCCGTGG + Intronic
975382022 4:73711621-73711643 ACCCAGTGTCACCTAGGCCAAGG + Intergenic
975719194 4:77233903-77233925 AGCCCATGTTCCAAAGGCCAGGG - Intronic
977557710 4:98501741-98501763 AGCAAATGTCACACAGGCCATGG + Intronic
981762920 4:148214012-148214034 ACCCCAGGTCACAGAGGTAATGG + Intronic
985191176 4:187374876-187374898 ACCACATGTGATACAGTCCAAGG + Intergenic
985627173 5:995111-995133 ACACCATGTCCCACTGGCCTGGG + Intergenic
985962837 5:3315994-3316016 ACCACGTGTCACACATGTCAGGG + Intergenic
991237626 5:64417867-64417889 ACCCCAGGCCATACAGCCCACGG + Intergenic
995785367 5:115821998-115822020 ACCACATATCACATAGGCCAAGG + Intergenic
997999287 5:138611139-138611161 ACCCCATGTCACATTGGCATGGG - Intronic
1001114722 5:168930054-168930076 AGTCAGTGTCACACAGGCCAGGG + Intronic
1001695664 5:173667940-173667962 ACCCCATGGCACACAAACCATGG - Intergenic
1002079223 5:176727692-176727714 ACACCTTCTCCCACAGGCCAAGG - Intergenic
1004920730 6:20373022-20373044 GCCCTATGTCACACAGGCTGGGG - Intergenic
1005952752 6:30643575-30643597 ACCCCAGGTCTCCCAGGGCAGGG - Intronic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1008654766 6:53600648-53600670 GCCCCTAGTCCCACAGGCCATGG - Intronic
1008966695 6:57319828-57319850 ACCCCATGTCCCACAGGTATGGG - Intronic
1011211880 6:84964344-84964366 ACCTCATGTCTCTCAGGACAGGG - Intergenic
1013014607 6:106149955-106149977 ACTCCATGTCAAAGAGGCCTTGG + Intergenic
1014809567 6:125870422-125870444 ATGCAATGTCACAGAGGCCATGG - Intronic
1017910086 6:158785080-158785102 ATGCCATGTCCCACAGGACACGG + Intronic
1018442499 6:163826012-163826034 AGCCCATTTCTCACAGGCCTAGG - Intergenic
1018522159 6:164662315-164662337 ACCCTATGTCACTAAGCCCAAGG - Intergenic
1019639763 7:2097126-2097148 ACCCCATGGCACCCAGGCACAGG + Intronic
1019720532 7:2567872-2567894 CCTCCATGTCACAGAGGGCAGGG + Intronic
1022691625 7:32662043-32662065 ACCTCATGTCACACCAGGCAGGG + Intergenic
1022822326 7:33973838-33973860 ACCCCATGTCACACAGGCCATGG - Intronic
1023041182 7:36174522-36174544 TACCCATGTTACACAGGCCCTGG + Intronic
1024659527 7:51479361-51479383 AGCCTGTGTCACACAGGCCCTGG - Intergenic
1025164469 7:56700457-56700479 ACACCATCTCTTACAGGCCATGG + Intergenic
1026740182 7:72974282-72974304 ACCCCACGTCACGCAGGCAGTGG - Intergenic
1027103551 7:75390788-75390810 ACCCCACGTCACGCAGGCAGTGG + Intergenic
1028483699 7:91335578-91335600 ATCTCATGTCAAACAGGCAATGG - Intergenic
1031768632 7:125812940-125812962 ACCCCATCAATCACAGGCCAAGG - Intergenic
1032478662 7:132229296-132229318 ATCCCAGGTCACACTGGACATGG - Intronic
1035234617 7:157488161-157488183 AGCCCACGTCTCCCAGGCCACGG + Intergenic
1036056343 8:5259008-5259030 ACCTCATGAGACAGAGGCCATGG - Intergenic
1036500358 8:9308533-9308555 AGCCCATATCACACGTGCCATGG - Intergenic
1036587199 8:10135227-10135249 CCCCAATGTCACAGAGGGCATGG - Intronic
1038527530 8:28289468-28289490 GCACCATGTGAAACAGGCCAAGG + Intergenic
1045963964 8:108001870-108001892 ACCCCCTGCCAGACAGGCCCTGG - Intronic
1047763262 8:127969839-127969861 CCTCTATGTCAGACAGGCCAGGG - Intergenic
1048456800 8:134585657-134585679 ACCGTATGTCACAGAGTCCACGG - Intronic
1049324801 8:142016343-142016365 GCCCCATGTCCCACTAGCCAGGG + Intergenic
1052986187 9:34489898-34489920 AACCCATGACACTCAGGCCAAGG + Intronic
1055910477 9:81344848-81344870 AACCCATACCACACAGGACAGGG + Intergenic
1057192912 9:93097126-93097148 ACCCCATGGCAGCCCGGCCAGGG + Intronic
1062461532 9:136664473-136664495 ACCCCATTTTACTGAGGCCAGGG + Intronic
1189235430 X:39483482-39483504 GCACCATGACACACAGGCAAAGG - Intergenic
1190101889 X:47528229-47528251 TCCCCATGTCACAGTGGCCCAGG + Intergenic
1194863445 X:99034723-99034745 ACTGCATGTCACACTGGCAAGGG - Intergenic
1196021861 X:110999228-110999250 ACCTCATGTAACACAGGCCAAGG + Intronic
1197655514 X:129112407-129112429 ACCTGATGTCACATAGCCCATGG - Intergenic