ID: 1022824532

View in Genome Browser
Species Human (GRCh38)
Location 7:33995529-33995551
Sequence GCCTTTCCATTTCTGAGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 262}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022824532_1022824533 -8 Left 1022824532 7:33995529-33995551 CCTAAGCTCAGAAATGGAAAGGC 0: 1
1: 0
2: 0
3: 25
4: 262
Right 1022824533 7:33995544-33995566 GGAAAGGCATTCCAGTAGCATGG 0: 1
1: 0
2: 3
3: 20
4: 289
1022824532_1022824536 20 Left 1022824532 7:33995529-33995551 CCTAAGCTCAGAAATGGAAAGGC 0: 1
1: 0
2: 0
3: 25
4: 262
Right 1022824536 7:33995572-33995594 CTCCACATTAGCATAAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022824532 Original CRISPR GCCTTTCCATTTCTGAGCTT AGG (reversed) Intronic