ID: 1022824532

View in Genome Browser
Species Human (GRCh38)
Location 7:33995529-33995551
Sequence GCCTTTCCATTTCTGAGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 262}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022824532_1022824536 20 Left 1022824532 7:33995529-33995551 CCTAAGCTCAGAAATGGAAAGGC 0: 1
1: 0
2: 0
3: 25
4: 262
Right 1022824536 7:33995572-33995594 CTCCACATTAGCATAAAACCAGG No data
1022824532_1022824533 -8 Left 1022824532 7:33995529-33995551 CCTAAGCTCAGAAATGGAAAGGC 0: 1
1: 0
2: 0
3: 25
4: 262
Right 1022824533 7:33995544-33995566 GGAAAGGCATTCCAGTAGCATGG 0: 1
1: 0
2: 3
3: 20
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022824532 Original CRISPR GCCTTTCCATTTCTGAGCTT AGG (reversed) Intronic
901858866 1:12061878-12061900 GCCTGCCTATTTCTGAGCCTTGG + Intergenic
903670750 1:25034104-25034126 GCCTTCCCCTTTCTGAGCCTGGG - Intergenic
904106295 1:28087942-28087964 GTCTTCCCATTTCGGGGCTTTGG + Intronic
905141430 1:35848282-35848304 GCTTATCCATTTCTGAGTTTAGG + Intronic
905530544 1:38675321-38675343 CAGTTTCCATTCCTGAGCTTAGG - Intergenic
906454447 1:45981659-45981681 CCTTGTACATTTCTGAGCTTAGG - Intronic
906476423 1:46172242-46172264 AGCTGTCCATTTCTGAGCCTCGG + Intronic
907262340 1:53229160-53229182 GCCCTACCATTTCTCAGATTTGG + Intronic
907492027 1:54814523-54814545 CCCTTTCCAGATCTGGGCTTCGG - Intronic
907744018 1:57194564-57194586 CCCTTTCCCTTTCTGAGTCTTGG + Intronic
907925387 1:58951046-58951068 CACTTGTCATTTCTGAGCTTCGG - Intergenic
908112344 1:60909804-60909826 GCATTTCCATTTCAGAGAATTGG - Intronic
909124968 1:71656314-71656336 CCCTTAACATTTCTGAGCCTTGG + Intronic
913052550 1:115130214-115130236 GACTTTACCTTTCTGTGCTTTGG + Intergenic
915561278 1:156689704-156689726 CCCGTCCCATTTCTGAGCTTGGG + Intergenic
920508816 1:206535864-206535886 GCCTTCCCATTTGTGAGTTATGG + Intronic
921188395 1:212689151-212689173 TCCTTTACATTTCTGATCTTTGG - Intronic
922318056 1:224459784-224459806 GCCTTGCTTTTTCTGAGCTCAGG - Intronic
1063161420 10:3421539-3421561 TCCTTTTCCTTTCTAAGCTTAGG + Intergenic
1063608216 10:7541477-7541499 GACTTTCCCTTTCGGATCTTGGG - Intergenic
1066653692 10:37681164-37681186 GCCCTTCCCTTTCTTAGCTAAGG - Intergenic
1066662739 10:37752762-37752784 GTCTTTTAATTTCTGAGTTTGGG + Intergenic
1067193161 10:44089630-44089652 GCCTTTCCTTCTCTGACATTTGG - Intergenic
1067741392 10:48898326-48898348 GCTTTGCTATTGCTGAGCTTGGG - Intronic
1067981352 10:51089086-51089108 GCATTTCCATTTTTCAGATTGGG + Intronic
1069944875 10:71978912-71978934 GCCTCCCCATGTCTGACCTTGGG + Intronic
1070097127 10:73348383-73348405 GCTTTTCCATTTCTGCTTTTGGG + Intronic
1070786483 10:79165170-79165192 CCCTTTCCCTTTCTGGGATTTGG + Intronic
1071791123 10:88955431-88955453 ACCTTTCCATTTCCCACCTTTGG + Intronic
1074002949 10:109390599-109390621 GACTTAACCTTTCTGAGCTTTGG - Intergenic
1075313925 10:121437190-121437212 TACTTTTCAATTCTGAGCTTTGG - Intergenic
1076114201 10:127884175-127884197 GCCTTCCCATTACTGAGCTCGGG + Intronic
1076293318 10:129364670-129364692 GCCTTCACATGTCTGAGCTACGG + Intergenic
1076374559 10:129974502-129974524 CCCTTAACTTTTCTGAGCTTGGG - Intergenic
1076896754 10:133316960-133316982 GTCTTTCCATCTCTGTGTTTGGG - Intronic
1076932971 10:133546097-133546119 GCCTTCACAGTTCTGTGCTTGGG - Intronic
1078015535 11:7610444-7610466 GCCTTCCCAGGTCTGAGCTTAGG - Intronic
1078360708 11:10665548-10665570 GCCTATCCAGCTCTGAGCTGAGG - Intronic
1079159480 11:17978722-17978744 CCCTTTCCCTTTCTGGGCCTAGG + Intronic
1079622866 11:22575879-22575901 GACTTTCCATTGTTGAGTTTGGG - Intergenic
1080768031 11:35314896-35314918 GTCATTTCATTTCAGAGCTTTGG - Intronic
1083265602 11:61545531-61545553 GCCATTCCATTTTTGACCATCGG - Intronic
1083397253 11:62400393-62400415 GCCGTTCCTTTTCTGAGCCCTGG + Intergenic
1083751095 11:64760985-64761007 TGCTTTACCTTTCTGAGCTTTGG + Intergenic
1084477328 11:69396326-69396348 GCCTCTGCATTTCTGACATTTGG - Intergenic
1084753538 11:71220408-71220430 GCCATTCCATTTCTGGGGGTAGG + Intronic
1086886663 11:92213982-92214004 GCCCCTCCATTTCTTAGCTTAGG - Intergenic
1090096458 11:123746592-123746614 TCCTTCCCATTTCAGAGCTGTGG - Intergenic
1090445035 11:126757056-126757078 GCCCATGCATTTCTGAGCATTGG + Intronic
1091847957 12:3672022-3672044 TCCTTCCCTTCTCTGAGCTTTGG + Intronic
1091975609 12:4822211-4822233 ATCTTTCCTTTTCTAAGCTTTGG - Intronic
1091983221 12:4883538-4883560 GCCTGTCCCTTTCTGAGCACAGG + Intergenic
1092157315 12:6291821-6291843 GCGTGTCCATTTCTGGGGTTTGG + Intergenic
1093003845 12:14031068-14031090 CCCTTTCCATTTTAGAGCTTAGG + Intergenic
1093546663 12:20356735-20356757 GCTTTTCAAATTCTGAACTTGGG + Intergenic
1093786887 12:23202744-23202766 ACTTTTCTATTTCTGAGCTTTGG - Intergenic
1094218105 12:27966655-27966677 GTTTTTCCATTTTGGAGCTTAGG - Intronic
1095194497 12:39297136-39297158 TCCTTGACATTTCTGTGCTTGGG - Intronic
1096153062 12:49326501-49326523 GCCTTCACCTCTCTGAGCTTTGG + Intronic
1097382599 12:58912924-58912946 TCCTTTCTGTTTCTGATCTTTGG + Intronic
1097731045 12:63128662-63128684 GGCTTTCCTTTTCTGAGCCTAGG - Intergenic
1099459442 12:82904597-82904619 CTCTTTGCATTTCTGTGCTTAGG + Intronic
1101716188 12:107315003-107315025 GGTGTCCCATTTCTGAGCTTAGG - Intergenic
1106054190 13:26222591-26222613 CCCTTTCCCTTGCTGTGCTTTGG + Intergenic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1107106826 13:36652455-36652477 GCTATTTCATTTCTGTGCTTGGG - Intergenic
1109248016 13:59981445-59981467 GCAATTCCATTTCTGAGACTTGG + Intronic
1112785239 13:102944199-102944221 GTCTTCCCCTTTCTGAGTTTTGG - Intergenic
1113584702 13:111457168-111457190 GACTTTTCATTTGTGAGCTCAGG - Intergenic
1117504121 14:56384702-56384724 TCCTTTCAATTTCTGTGTTTTGG + Intergenic
1119060559 14:71469953-71469975 GCCTTGCCAGTCCTGAGCCTGGG + Intronic
1119081919 14:71702699-71702721 GCCTTTCCAGTTTTGAATTTGGG - Intronic
1120720144 14:87881715-87881737 TCCTTTACATTTCTGAGTTGAGG - Intronic
1121656281 14:95598128-95598150 GTCTTTCCCTCCCTGAGCTTTGG - Intergenic
1122368188 14:101210149-101210171 GCCTTTGCATTTATGACTTTTGG - Intergenic
1122769847 14:104093077-104093099 GTCCTTCCATTTCTCAGCTCTGG + Intronic
1124721278 15:32113023-32113045 GCCTTTCCATGCCTGGACTTTGG + Intronic
1125976510 15:43957557-43957579 GGCTTTCAATTTCTAATCTTTGG + Intronic
1126876308 15:53045473-53045495 GTCTTTCCATTTCTCTGCCTTGG + Intergenic
1128294187 15:66503916-66503938 GTCTTTCCACTGGTGAGCTTTGG - Intronic
1128534388 15:68479672-68479694 GCTTTTCCCTTTATGAGGTTTGG - Intergenic
1129713339 15:77832675-77832697 GCCTTGCCCCTTCTGAGCTGGGG - Intergenic
1130207685 15:81892991-81893013 GACTTTCTATTTCTTAGCTGAGG - Intergenic
1130671287 15:85915172-85915194 GCATTACCATTTTTGACCTTCGG + Intergenic
1130732888 15:86517553-86517575 GCTTTCCCATTTCTGGGCTCTGG + Intronic
1131398771 15:92108106-92108128 GGCTTTCCATCTCTCAGCTTTGG - Intronic
1131528862 15:93175089-93175111 GTCCTCCCTTTTCTGAGCTTTGG + Intergenic
1133467679 16:6043547-6043569 CCCTTTCCCTTTTTGAGTTTAGG - Intronic
1134477019 16:14583009-14583031 ACCTTTCGATCTCTAAGCTTGGG - Intronic
1134560699 16:15206983-15207005 GACTTGCCTTTTATGAGCTTGGG - Intergenic
1134921237 16:18118598-18118620 GACTTGCCTTTTATGAGCTTGGG - Intergenic
1137534175 16:49305042-49305064 GCCTTTTTATTTCTGAGATGCGG - Intergenic
1138388168 16:56650765-56650787 GTCTTTCCATTTCTGTGATGGGG - Intronic
1138692082 16:58777548-58777570 GCCTGTGAAATTCTGAGCTTGGG + Intergenic
1138740726 16:59306418-59306440 TCCTTTCCATTTCTGATATTTGG + Intergenic
1138972148 16:62158635-62158657 ACCTTTACATTGCTGAGTTTCGG - Intergenic
1139801129 16:69523785-69523807 GGCTTTCCATCTGTGAGCGTGGG - Intergenic
1140568175 16:76068917-76068939 GGCATTCCATTTCTGTGTTTTGG - Intergenic
1142346024 16:89554410-89554432 GCCATTTCTTTTCTGTGCTTTGG + Intronic
1142688874 17:1592945-1592967 GCCTTTGCATTTCGGGGCTGGGG - Intronic
1142921121 17:3187423-3187445 GGCTTTCCATTTGTGATCTGAGG + Intergenic
1143541372 17:7571500-7571522 CCCTTCCCATTTATGGGCTTGGG - Exonic
1146717734 17:35100496-35100518 GCCTTTCCATTTGTTAGATGGGG - Intronic
1146910516 17:36645589-36645611 GCCTTTCCATTCCTGGGTTAAGG + Intergenic
1146974822 17:37102154-37102176 CCCTTTACATTTCAGAGCTGTGG - Intronic
1148827673 17:50405934-50405956 GACTTTTCCTCTCTGAGCTTTGG - Intergenic
1150888224 17:69112348-69112370 TCCTTTGCACTTCTGAGCCTTGG - Intronic
1151707832 17:75780091-75780113 GACTTTCTATTGCAGAGCTTTGG - Intronic
1152582668 17:81173503-81173525 GGCTTTCCAGCTGTGAGCTTGGG - Intergenic
1155984569 18:32216504-32216526 TACTTTACATTTCTGAGTTTTGG + Intronic
1156129315 18:33951016-33951038 GATTTTCTATCTCTGAGCTTTGG - Intronic
1159797685 18:72864742-72864764 ACCTTGCCATCTCTGTGCTTTGG - Intronic
1159865042 18:73693385-73693407 GACTACCCCTTTCTGAGCTTAGG - Intergenic
1159928205 18:74287856-74287878 GCATTTCCCTTTCTGTGATTTGG - Intronic
1160706884 19:534023-534045 CGCTTTCCTTTTCTGAGCCTGGG + Intronic
1162429298 19:10617705-10617727 CCCTTCCCTTTTCTGAGCCTCGG + Intronic
1164695318 19:30239605-30239627 TCCTGTGCATTTCTGAGCATGGG + Intronic
1164870881 19:31641684-31641706 GCTTTTCCATCTCTGATCATGGG + Intergenic
1166531285 19:43545034-43545056 GCCTTTCTTGTTCTGACCTTTGG + Intronic
1168286513 19:55337419-55337441 GACTTGCCATCTCTGGGCTTTGG - Intergenic
1168452353 19:56476402-56476424 GACTTTGCATCTCTGAGCTTCGG - Intronic
925387262 2:3470696-3470718 CACCTTCCTTTTCTGAGCTTGGG + Intronic
925999640 2:9319842-9319864 GCCTTTCTATTTCTGTCGTTGGG + Intronic
926801621 2:16665178-16665200 ACTTTTCCAATACTGAGCTTTGG - Intronic
928036619 2:27830093-27830115 GCTGTTCCATTTCTGATCTGTGG + Intronic
929897924 2:45977718-45977740 TCATTTTCATTTCTGAGCCTGGG - Intronic
931816771 2:65911551-65911573 GCCATTCAATTTCTGAACATTGG + Intergenic
934035898 2:88088300-88088322 CCCCTTCCATTTCTGAGCCCAGG + Intronic
934519805 2:95012996-95013018 GCCTTTCCATTTGTGGGATGTGG - Intergenic
934714169 2:96533674-96533696 TTTTTTCCATTCCTGAGCTTGGG + Intergenic
936982088 2:118274360-118274382 GCCTTTTCATACCTGAGCTCTGG + Intergenic
937556967 2:123170107-123170129 CCTTTCCCACTTCTGAGCTTTGG - Intergenic
938243129 2:129758359-129758381 TCCTTTCCATTGCTGAGGTGTGG - Intergenic
938421163 2:131147987-131148009 GCGTTCCCATTTCTGGCCTTTGG + Intronic
940393634 2:153162509-153162531 GCCTTTCCTTATCTGAGGCTGGG - Intergenic
941328429 2:164145489-164145511 ACATTTTCATTTCTGAGCTAAGG + Intergenic
942837662 2:180319962-180319984 GGCTTTGTATATCTGAGCTTTGG + Intergenic
945285089 2:208074178-208074200 CAGTTACCATTTCTGAGCTTCGG + Intergenic
945714044 2:213336232-213336254 GTCTTTACAGTTCTGTGCTTGGG - Intronic
946287669 2:218717403-218717425 GCCTTGCCCTTTATCAGCTTCGG - Intronic
947529972 2:230902644-230902666 GACTTTGCATCTCTGAGATTGGG + Intergenic
949066662 2:241994816-241994838 GCCTTTCCTCCTCTGAGGTTTGG - Intergenic
1170321094 20:15098852-15098874 AGCTTTTCACTTCTGAGCTTTGG - Intronic
1170601200 20:17843065-17843087 GCCTTTCCCTCTGTGAGCTGAGG + Intergenic
1172639052 20:36430105-36430127 TCCCTTCCTTTTCTGAGCCTGGG - Intronic
1172701318 20:36855261-36855283 AGCTTTCCCTTTCTGAGCCTCGG - Intronic
1172769284 20:37369699-37369721 TTCTTTTCATTTCTGATCTTGGG + Intronic
1173818796 20:46007747-46007769 GCCTTCCCCTTTGTCAGCTTAGG - Intergenic
1176079125 20:63262848-63262870 GCCCTTCGACTTCTGAGCTGTGG - Intronic
1177169335 21:17638487-17638509 GCTGTGCCATTTCTGAGCCTTGG - Intergenic
1178796589 21:35750645-35750667 GCTTTTTCCTTTCTGAGCTGCGG - Intronic
1178846980 21:36182200-36182222 GACTCACCATTTCTGAGATTGGG + Intronic
1179097067 21:38325389-38325411 CCCTTCCCATTGCTGAGCTGTGG - Intergenic
1179595483 21:42440231-42440253 GCCTTTCCAGCTCTGCGCTTTGG + Intronic
1179878865 21:44285260-44285282 TCCTTTCCTTCTCTGAGCCTCGG - Intergenic
1180949058 22:19712976-19712998 ACCTTTATGTTTCTGAGCTTTGG - Intergenic
1181947207 22:26527656-26527678 GCCCTTCCTTCTCTGTGCTTTGG + Intronic
1182453454 22:30434645-30434667 TCCTTTCCCTTTCTGGGCCTTGG + Intergenic
1182748824 22:32625752-32625774 GACATTCCATGGCTGAGCTTTGG + Intronic
1183813140 22:40275032-40275054 GCCTTCCCATGTCTGAGGATTGG + Intronic
1185387978 22:50545141-50545163 GCCTTCCCTTATCTGAGCTGAGG - Intergenic
951895793 3:27608636-27608658 GACTGTCCATTTTTGTGCTTAGG + Intergenic
952154481 3:30627977-30627999 ACTTTTCCATTCCTGTGCTTTGG + Intronic
952437638 3:33287972-33287994 AGCTGTCCATATCTGAGCTTTGG - Intronic
952923691 3:38306624-38306646 GGCTTCCCATCTCTGAGCTTCGG - Intronic
953131932 3:40148323-40148345 ACTTTTCCCTTTCTTAGCTTGGG + Intronic
953964003 3:47288297-47288319 TCCCTTCCCTTTCTGGGCTTGGG - Intronic
955780129 3:62475848-62475870 GCATTTCCATTTCTCAAATTGGG - Intronic
956974407 3:74563642-74563664 GCATTTCCTTTTCAGAGCCTAGG - Intergenic
958786499 3:98602432-98602454 GCTTTGCCATTTGTGAACTTAGG + Intergenic
960980353 3:123218341-123218363 TCCATTCCATTTCTGGGCTTTGG - Intronic
961037125 3:123650176-123650198 GCCTTTCCCTTCCTGGGCCTTGG + Intronic
961439649 3:126945274-126945296 GCCCTTCCAGCTCTGTGCTTTGG - Intronic
963052150 3:141151517-141151539 GCCTTTCCTTTACTCAGCTTTGG - Intergenic
963441853 3:145350072-145350094 GACTTTCCATGTGTGAGATTAGG - Intergenic
967548924 3:190766677-190766699 GCCCTTCCATTTGTGAGATGTGG + Intergenic
967846826 3:194050682-194050704 GCCTTACCTTTTGAGAGCTTTGG - Intergenic
968675098 4:1872832-1872854 GCCATCCCATTTATGAACTTGGG + Intronic
971325706 4:25642018-25642040 GCCTATCCCTTTCAGAGTTTTGG - Intergenic
971529460 4:27666913-27666935 TACTTACAATTTCTGAGCTTTGG + Intergenic
971663222 4:29447379-29447401 CCCTCTCCATTTCTGTGGTTTGG - Intergenic
972695516 4:41441671-41441693 GCCATTTCATTTAGGAGCTTAGG + Intronic
975725263 4:77285420-77285442 GCATTTGCATTTGTGAGGTTTGG - Intronic
976327075 4:83783881-83783903 ACCTTTCTATTTCAGTGCTTTGG + Intergenic
976774749 4:88696178-88696200 CCCTTTCTACTTCTGAGCTGGGG + Exonic
978853083 4:113361605-113361627 TCCTTTCCATTTCTTAGATTTGG + Intronic
979398835 4:120222441-120222463 CCCCTTCCATTTTTGAGCCTTGG - Intergenic
982228093 4:153183910-153183932 GTCTTAACTTTTCTGAGCTTTGG + Intronic
983779030 4:171644871-171644893 GCCTTTCCCTTTCTGTGGTTGGG - Intergenic
985287290 4:188349404-188349426 GCCTTTGCCTTTTTGAGCTTTGG + Intergenic
985301639 4:188496383-188496405 GCCCTCCCAGCTCTGAGCTTTGG + Intergenic
985730823 5:1547570-1547592 GGATTTCCATTTCTAAGCCTTGG + Intergenic
985857621 5:2442469-2442491 TCATTTCCTTTTCTGAGGTTTGG - Intergenic
987640364 5:20604548-20604570 CCCTCTCCATTTTTGATCTTGGG - Intergenic
990765650 5:59178944-59178966 GCCTGTCCATTCCTCAACTTAGG + Intronic
994493917 5:100486131-100486153 GTCTTTCCACTTTTGAGTTTTGG - Intergenic
994573526 5:101545032-101545054 CTCTTTCCAGTTTTGAGCTTGGG - Intergenic
995454073 5:112333536-112333558 ACCTATCCATTTCTGAGAATAGG - Intronic
995455483 5:112347642-112347664 CCCTTTCACTGTCTGAGCTTTGG + Intronic
995497761 5:112765676-112765698 GCCATTACATTTGTGAACTTTGG - Intronic
996340242 5:122429814-122429836 TCCTTTCCCTTTCCCAGCTTTGG - Intronic
997511898 5:134459885-134459907 GCCTCGACCTTTCTGAGCTTAGG - Intergenic
998203567 5:140144014-140144036 GCTTGTCCATTTCTGAGGCTGGG - Intergenic
1000276561 5:159741899-159741921 GGGGTTCCATTTCTCAGCTTTGG - Intergenic
1000457856 5:161474167-161474189 GCTTTTCCTTATCAGAGCTTGGG + Intronic
1000883771 5:166727243-166727265 GCCTTTTCATTTCTGTGACTAGG - Intergenic
1001248522 5:170124999-170125021 CCCTTTCCTTCTCTGGGCTTGGG - Intergenic
1004412967 6:15398957-15398979 TCCTTTCCAATTCTCTGCTTTGG + Intronic
1005458882 6:26048714-26048736 TCCTTTTCATTCCTGAGTTTGGG + Intergenic
1006480996 6:34294068-34294090 GCCTTGACCTTCCTGAGCTTAGG + Intronic
1007910754 6:45512160-45512182 GCTTTTTCCTTTCTGAGTTTTGG + Intronic
1008439409 6:51515639-51515661 CCCTTAACATTTCTGAGCTCTGG - Intergenic
1009730332 6:67594587-67594609 ACTTTTCCATTTCACAGCTTAGG + Intergenic
1012129201 6:95469931-95469953 GATTGTCCATTTCTGGGCTTAGG - Intergenic
1012862489 6:104576277-104576299 GCCTCTGCATTTCTGATCCTGGG - Intergenic
1014046809 6:116898216-116898238 GCCTTTCCAGTGGTGAGCTGGGG + Intronic
1015814182 6:137191181-137191203 GCCCTTTCTTTTCAGAGCTTAGG + Intergenic
1016845184 6:148562298-148562320 GCTGTTTCATTTCAGAGCTTTGG + Intergenic
1017454114 6:154584041-154584063 GCCTGTCCATTTTTGAGAGTGGG + Intergenic
1017973348 6:159332303-159332325 GCCTATCCTTTCCTGAGTTTTGG - Intergenic
1019938396 7:4270999-4271021 GCCTGTGGATTTCTGGGCTTGGG + Intergenic
1021179378 7:17488088-17488110 GCCTTGCCATTATTGAGATTTGG - Intergenic
1021916284 7:25436238-25436260 GCCTATTCATTTCTGGGATTTGG - Intergenic
1022196516 7:28072986-28073008 GAGTTTCCTTTTCTGAGCTTTGG - Intronic
1022824532 7:33995529-33995551 GCCTTTCCATTTCTGAGCTTAGG - Intronic
1023667806 7:42542876-42542898 CCCTTTCCCTTTTGGAGCTTAGG - Intergenic
1024963895 7:55005005-55005027 TCCTTTCCTTTTCTGAATTTGGG - Intergenic
1026775046 7:73226128-73226150 GGCTTTCCCTCTCTGAGCCTTGG - Intergenic
1027015902 7:74779499-74779521 GGCTTTCCCTCTCTGAGCCTTGG - Intronic
1027072127 7:75166438-75166460 GGCTTTCCCTCTCTGAGCCTTGG + Intergenic
1030433808 7:109488719-109488741 CTCTTTGCTTTTCTGAGCTTTGG + Intergenic
1031550247 7:123101852-123101874 GCCTTTTAATTTGTGTGCTTAGG - Intergenic
1031842010 7:126754071-126754093 GCCTATCCATTTCTAATGTTTGG - Intronic
1035088229 7:156279488-156279510 GTATTTTCATTTCTCAGCTTGGG - Intergenic
1035839155 8:2792071-2792093 TCCTTGCCATTGCTCAGCTTTGG + Intergenic
1036126390 8:6066915-6066937 CCTTTTCCATTTATGAGTTTTGG + Intergenic
1036337871 8:7888603-7888625 TAATTTCCATTTCTGAGCCTTGG + Intergenic
1037976852 8:23219983-23220005 CACTTTCCCTCTCTGAGCTTTGG + Intronic
1038079922 8:24122641-24122663 GCCTTTCCCTGTGTGAGTTTGGG - Intergenic
1039382454 8:37099080-37099102 ACCTTTCCCTATCTGAGATTTGG + Intergenic
1040554223 8:48464954-48464976 GCCATCCCATTTCTGAGATAAGG - Intergenic
1041925386 8:63230708-63230730 GCCTCTCTATTTTTGAGGTTTGG + Intergenic
1042156245 8:65847305-65847327 CCCTCTCCACTTGTGAGCTTGGG - Intergenic
1042748626 8:72134200-72134222 GCCTATCCCTTTCTGGGTTTCGG + Intergenic
1042798738 8:72693592-72693614 GCCTATATATTTCTGAGCCTGGG - Intronic
1042961772 8:74310982-74311004 GCCTTTCCAGATCTGAAATTGGG + Intronic
1044458890 8:92421686-92421708 GCCTTCACATTTCTGATCTATGG + Intergenic
1044483247 8:92718010-92718032 ACCTCTCCATTGCTCAGCTTGGG - Intergenic
1045209160 8:100077108-100077130 CCCTTTTCATTTCTGATATTGGG + Intronic
1046877369 8:119270313-119270335 GTCTTTCCACCTCTGATCTTTGG - Intergenic
1047895249 8:129359396-129359418 GCCATTCCATTTATCACCTTTGG - Intergenic
1048392746 8:133983746-133983768 TCTTTTCCATTTCTTAACTTTGG + Intergenic
1048659364 8:136578918-136578940 GCCTTTCATTTTCTGAGATCAGG - Intergenic
1049846434 8:144804103-144804125 TGCTTTCCTTCTCTGAGCTTAGG + Exonic
1050583873 9:7089823-7089845 GCCTTTCCTTTGCTCAGATTTGG + Intergenic
1052280216 9:26724237-26724259 TACTTACAATTTCTGAGCTTTGG + Intergenic
1052545399 9:29871181-29871203 GCATTTCCTTTTCTCTGCTTAGG + Intergenic
1053301126 9:36950409-36950431 TCCCTTCCAGCTCTGAGCTTTGG - Intronic
1053429404 9:38032270-38032292 TCCTAGACATTTCTGAGCTTCGG - Intronic
1053523496 9:38805993-38806015 GCTTTTACATTTCTGGGCCTCGG - Intergenic
1053608417 9:39683332-39683354 GTCTTTCCATTTTTGAGATTGGG + Intergenic
1053866261 9:42439696-42439718 GTCTTTCCATTTTTGAGATTGGG + Intergenic
1054195723 9:62030409-62030431 GCTTTTACATTTCTGGGCCTCGG - Intergenic
1054245113 9:62659077-62659099 GTCTTTCCATTTTTGAGATTGGG - Intergenic
1054559241 9:66693608-66693630 GTCTTTCCATTTTTGAGATTGGG - Intergenic
1054642685 9:67558280-67558302 GCTTTTACATTTCTGGGCCTCGG + Intergenic
1055651948 9:78414846-78414868 TCCTTTCAGTTTCTAAGCTTTGG + Intergenic
1056341267 9:85634775-85634797 GCAGTTCCATTTCAGTGCTTAGG - Intronic
1056692320 9:88818351-88818373 GTCTATCCATTTCTGAGCCATGG + Intergenic
1057832136 9:98415540-98415562 GCCTTTTCATCTCTGTGCTCAGG + Intronic
1057883218 9:98808594-98808616 GGCATTGGATTTCTGAGCTTTGG + Intronic
1058245029 9:102612294-102612316 GCCCTGCAATCTCTGAGCTTGGG - Intergenic
1059776308 9:117478744-117478766 CCTTTTCCTTTCCTGAGCTTAGG + Intergenic
1060656539 9:125376112-125376134 CCCTTTGCATGTCTGAGCCTCGG - Intergenic
1061805559 9:133135699-133135721 TCCTTTCCCTTGCTGAGCCTTGG + Intronic
1061918595 9:133769951-133769973 GCCTTCCCTGTTCTGAGCTGTGG + Intronic
1062073160 9:134570015-134570037 GCCTTTCCGTTTTTGAGGCTTGG + Intergenic
1186885540 X:13909718-13909740 TCCTTAACCTTTCTGAGCTTCGG - Intronic
1187983267 X:24782511-24782533 GGCTTCCAAATTCTGAGCTTAGG + Intronic
1188873614 X:35403508-35403530 GCCTTTCCTTCTCTGAAGTTAGG - Intergenic
1190433552 X:50401564-50401586 CCCTTTACCTCTCTGAGCTTTGG - Intronic
1193051458 X:77103991-77104013 GTCTTTCCATGTTTTAGCTTAGG + Intergenic
1195928462 X:110049758-110049780 GCTTTTCCATGTGTAAGCTTGGG + Intronic
1196652083 X:118178362-118178384 GCTTTTCCATTTCCTAGCTAGGG - Intergenic
1196884508 X:120230128-120230150 GCCCTTTCATTTCGGAGCTGAGG - Intergenic
1199835216 X:151583128-151583150 GCCTTTTCATTACTTAGCATTGG - Intronic
1200240178 X:154489248-154489270 GCCTCTCCATTCCTGAGTGTGGG - Intronic
1200310003 X:155068539-155068561 GCCTTTGCATTTCTCTGCTGAGG - Intronic