ID: 1022826614

View in Genome Browser
Species Human (GRCh38)
Location 7:34020803-34020825
Sequence CCTGCTTTGCAGGCAGCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 269}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022826606_1022826614 22 Left 1022826606 7:34020758-34020780 CCAGTTAGTAGTGGACAAAATAA 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1022826614 7:34020803-34020825 CCTGCTTTGCAGGCAGCATGGGG 0: 1
1: 0
2: 3
3: 27
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022826614 Original CRISPR CCTGCTTTGCAGGCAGCATG GGG Intronic
900292651 1:1930024-1930046 CCTGCTTCCCAGCCTGCATGTGG + Intronic
900892992 1:5463110-5463132 TCTGCTTAGCAGGCAGGAGGAGG - Intergenic
901658936 1:10786816-10786838 GCTGCCTTTCAGGCAGAATGGGG - Intronic
902371900 1:16012817-16012839 CCTGCTTTGCAGGACTCTTGTGG + Intergenic
903051598 1:20605226-20605248 CCTGCTTTGCAGGCTCACTGAGG - Intronic
903981505 1:27192036-27192058 GCTGCATTTCAGGAAGCATGGGG + Intergenic
904483497 1:30808476-30808498 GCTGCATTCCAGGCAGCAGGTGG - Intergenic
905477496 1:38239284-38239306 CCTGCAGTGCAGGCCACATGGGG + Intergenic
906394645 1:45451500-45451522 TGTGCTGGGCAGGCAGCATGTGG - Intronic
906689745 1:47784775-47784797 CCTGCTTTGCAGGCCGCCCAGGG + Intronic
907208175 1:52793730-52793752 TCTGCTTTGCAGAAAGCATAGGG + Intronic
909418208 1:75431556-75431578 CCTTCTTTGCAGAGAGCCTGTGG + Intronic
910501540 1:87897316-87897338 TCTGCTTTAGAGTCAGCATGTGG - Intergenic
910803322 1:91166295-91166317 TGTGCTTTGCAGCCAGCAGGTGG + Intergenic
912739310 1:112178833-112178855 CCAGCTCTGCATGCATCATGAGG + Intergenic
916787459 1:168096848-168096870 CCTCCTCTTCAGGCAGCAGGAGG - Exonic
920301492 1:204991775-204991797 CCAGCTTCGCATGCTGCATGGGG + Intronic
920679720 1:208063226-208063248 TCTGTCTTGCAGGTAGCATGTGG + Intronic
921278342 1:213541496-213541518 TATGCTTTGCAGACACCATGGGG - Intergenic
922601993 1:226863479-226863501 ACTGCTTAGCAGACAGCGTGGGG - Intergenic
923219064 1:231876382-231876404 CAGGCTTTACAGTCAGCATGAGG - Intronic
1062788032 10:281518-281540 GCGGCTTTGCAGCCAGCCTGTGG - Intronic
1063514515 10:6681931-6681953 CCTGTTTTTCAGGCAGAAAGAGG + Intergenic
1064280155 10:13944145-13944167 CCTGCTGTGCAGCCAGTCTGTGG - Intronic
1065667181 10:28074979-28075001 CATGCTTCACAGGCAGCCTGCGG - Intronic
1067098456 10:43317640-43317662 CCTGCTGTTCATGCAGCACGTGG + Intergenic
1067223643 10:44361689-44361711 CCTGGTTTACAGGGAGTATGAGG + Intergenic
1067568988 10:47358118-47358140 CCAGCTATGCAGCCGGCATGAGG - Intergenic
1067839666 10:49665776-49665798 TCTGCTTAGCAGGCGGCATCAGG + Intergenic
1071246851 10:83774105-83774127 CCTGCCTTCAAGACAGCATGTGG + Intergenic
1071378422 10:85033671-85033693 CCTGCTTTGATGGCCTCATGGGG + Intergenic
1071717375 10:88110909-88110931 CCTGCTTTGCTGGCAGTACATGG - Intergenic
1073873143 10:107889224-107889246 CCTGCCTTGCAGGCTGCCTTTGG + Intergenic
1074381137 10:112981689-112981711 TCTGCTTTGCATGTGGCATGTGG - Intronic
1074942485 10:118248741-118248763 GCTGCTTTGCAGAGAGCACGTGG + Intergenic
1075298318 10:121297676-121297698 CCTACTTTGAAGGCAGGAAGAGG - Intergenic
1075510991 10:123073001-123073023 CCAGAGTTCCAGGCAGCATGAGG - Intergenic
1075587925 10:123670805-123670827 CATGTCTTGCAGGCAGGATGAGG + Intronic
1076242713 10:128921771-128921793 CATGCTGTGCAGGCATCCTGTGG - Intergenic
1077437374 11:2549409-2549431 CCTGCTTTGGGGGCAGTTTGAGG + Intronic
1077776185 11:5274277-5274299 GCTGCCTTGCAGGAAGCCTGTGG + Intronic
1079107039 11:17578369-17578391 CCTGCTGGGCAGGCAGCAGCTGG - Exonic
1079355054 11:19723736-19723758 CCTGCTGGGCCGGCAGCACGGGG - Intronic
1080898135 11:36462763-36462785 CCTGTTTTGCAACCAGGATGAGG + Exonic
1083261718 11:61526762-61526784 CCTCCTTTGCAGGCACCATGAGG - Intronic
1083265928 11:61546859-61546881 CCTTCTGTGCAGTCAGGATGGGG - Intronic
1083322231 11:61854901-61854923 CCTGCTTGCCAGGCAGCAGCAGG - Intronic
1083802263 11:65053459-65053481 CCTGGGGTGCAGGCAGCAAGAGG + Intronic
1084276048 11:68051456-68051478 CCTGCGTTGCTGGCAGAATGGGG + Intergenic
1084367746 11:68713958-68713980 CCTGCTTTGAAGTCAGCACAGGG - Intronic
1085163360 11:74370305-74370327 CTTGCTTTGCACGGAGCGTGGGG - Intronic
1087336467 11:96850824-96850846 CCTTCTTCCCAGGCAGCAGGAGG - Intergenic
1088446216 11:109931592-109931614 CCTGGTCTGCAGGCGGCCTGTGG - Intergenic
1090983888 11:131748882-131748904 CCTGCTTTCCTCACAGCATGGGG + Intronic
1095765208 12:45886840-45886862 CCTAGGCTGCAGGCAGCATGGGG + Intronic
1096232073 12:49902395-49902417 CCTTCTTTGCAGGGAGCATCTGG + Intronic
1096542126 12:52313778-52313800 CCTGTTTGGTGGGCAGCATGAGG + Intergenic
1097334252 12:58364570-58364592 CCTGCATTTCAGGCAGAATTAGG + Intergenic
1097414144 12:59293760-59293782 CTTGCTTTCAAGGCAGCAAGTGG - Intergenic
1101123799 12:101610473-101610495 TATCCTTAGCAGGCAGCATGTGG + Intronic
1101237013 12:102799857-102799879 CCTTCTTAGGAGGTAGCATGAGG - Intergenic
1101740254 12:107494906-107494928 CCTGTTTTGCAGGCTCCAGGGGG - Intronic
1102422274 12:112813409-112813431 CCTCCTTTCCAGGCACCAGGTGG - Intronic
1102544701 12:113646086-113646108 CCTGCTTTGCAGAGGGGATGCGG + Intergenic
1104999264 12:132678683-132678705 CCTGCTCTTCAGCCTGCATGAGG - Intronic
1106705031 13:32271046-32271068 CCAGATATGCAGGTAGCATGAGG + Intronic
1109600963 13:64627924-64627946 GCTGCTTTGCAGGCAACCTTTGG - Intergenic
1110185021 13:72663837-72663859 CCTGCTTTGCAATTTGCATGAGG + Intergenic
1112225112 13:97532042-97532064 GAGGCTTTGGAGGCAGCATGAGG + Intergenic
1112225126 13:97532121-97532143 CCAACTTTGCAGGCTGCAGGAGG + Intergenic
1113379888 13:109794349-109794371 CTTGCTTCCCGGGCAGCATGGGG - Intergenic
1115442886 14:33456346-33456368 CCTGCTTAGCAGCCCTCATGAGG - Intronic
1120793066 14:88603014-88603036 CTTGCTGAGCAGGCAGCTTGAGG + Exonic
1121224367 14:92310445-92310467 CCGCCTTTGCAGCCAGCACGTGG - Intergenic
1121412209 14:93756008-93756030 CCTGGATTGCAGACAGCACGAGG - Intronic
1121698019 14:95928587-95928609 CATGCTCTGCAGGCAGCTGGTGG - Intergenic
1121713328 14:96055178-96055200 CCTGCTCTGCAGGTCCCATGGGG + Intronic
1122030325 14:98907355-98907377 CCAGCCCTGCCGGCAGCATGGGG + Intergenic
1122355356 14:101119892-101119914 CCTGCTCGGCAGGCAGCCTCGGG + Intergenic
1123136009 14:106027729-106027751 CCTGATTTGCAGGTAGCAGTGGG + Intergenic
1124186658 15:27535959-27535981 CTTGCTTTGCATGCAGAATTGGG + Exonic
1126380591 15:48042785-48042807 CTTGCTTTGGAAGCTGCATGTGG - Intergenic
1127464088 15:59227009-59227031 CCTGCCCTGCAGGCAGGCTGAGG + Intronic
1127592447 15:60439078-60439100 CTTGCTTTGCATGCAGTGTGAGG + Intronic
1127836284 15:62793723-62793745 GCTGTTTTGCAGGCTGCTTGAGG + Intronic
1127836521 15:62795116-62795138 GCTGTTTTGCAGGCTGCTTGAGG + Intronic
1128671027 15:69574902-69574924 CCAGATGTGCAGGCAGCGTGGGG + Intergenic
1128678044 15:69626197-69626219 CCTGCTTTTCAGTCAGCCTCTGG - Intergenic
1128897390 15:71387900-71387922 CCTGGCTGGCAGGCAGCAAGAGG - Intronic
1130374112 15:83312794-83312816 CCTGGGTTGCAGGGAGTATGAGG - Intergenic
1130578035 15:85109875-85109897 CCTGCTTTGAGGGCAGGATTGGG + Intronic
1130967567 15:88708596-88708618 TCTGGTCTGCAGGCAGCATTAGG - Intergenic
1131066137 15:89436019-89436041 GCTGATATGCAGGCAGCCTGGGG + Intergenic
1131069560 15:89457336-89457358 ACTCCTTTGCAGCTAGCATGTGG - Intergenic
1132820968 16:1870456-1870478 CCTGAATTTCAGGCAGCCTGTGG + Intronic
1134346032 16:13392825-13392847 CGTGCTTTGCAGGCAGTCTTTGG - Intergenic
1135508692 16:23062158-23062180 GGTGTTTTGTAGGCAGCATGAGG + Exonic
1136104644 16:28021155-28021177 CGGGCTATGCAGGAAGCATGAGG + Intronic
1136674819 16:31893276-31893298 CCTAGGCTGCAGGCAGCATGGGG + Intronic
1137067375 16:35862518-35862540 ACTGCCTTGAAGGCAGCATGAGG + Intergenic
1139261759 16:65600740-65600762 CCTGCTGTTCAGGCAGTAAGTGG - Intergenic
1140615810 16:76661928-76661950 CCTTTTTTTCAGGCATCATGAGG - Intergenic
1142377603 16:89714349-89714371 CCTGCTTTAAAGGCACTATGTGG + Intronic
1142388145 16:89780083-89780105 CCTGCTGTGCGCACAGCATGTGG - Intronic
1142417669 16:89951723-89951745 TCTGCATTCCAGGCAGCAGGAGG + Intronic
1142610489 17:1107137-1107159 TCTACTTTGCTGCCAGCATGGGG - Intronic
1142998592 17:3776429-3776451 CCTTCTCTGCAGTCAGCGTGGGG - Intronic
1143163925 17:4888254-4888276 CCTACTTTGGAGGTAGCAGGTGG - Intronic
1144278694 17:13702510-13702532 CCTTCTTTGTAGGCAGTTTGAGG - Intergenic
1144359830 17:14481408-14481430 CCTGCTTGCTAAGCAGCATGTGG + Intergenic
1145241652 17:21243809-21243831 CCTGCTCTCCAGGCAGCCTGGGG + Intronic
1146380609 17:32324446-32324468 CGTGCTTTCCAGCCAGCACGGGG - Exonic
1146642317 17:34550607-34550629 CCTCCCTTGCAGGCGGCAAGTGG - Intergenic
1148046457 17:44747936-44747958 TCTGCCTTGCTGGCAGCAAGGGG - Intronic
1150140933 17:62727948-62727970 CCTGTGATGCAGGCAGCAGGTGG + Intronic
1151370677 17:73644686-73644708 CTAACTTTGCAGGCAGCATCTGG + Intergenic
1151512411 17:74569387-74569409 CCGGCTCTGCAGGCTGCAAGGGG - Intergenic
1152080250 17:78182766-78182788 CCTGCTTTGCAGGTAGCAGGTGG - Intronic
1152515160 17:80819042-80819064 CCTGGTTTGCAAACAGCCTGCGG + Intronic
1152748887 17:82053430-82053452 CCTGCTGTGCAGGCTGCAGCGGG - Intronic
1152910257 17:83000913-83000935 ACTGCTGTGCAGGCAGAAAGTGG + Intronic
1153366908 18:4266556-4266578 CCTGATTAGCAGGCAACAAGAGG + Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1153949951 18:10049884-10049906 CCGGCTTTGCTGGAAGCATCTGG - Intergenic
1159370820 18:67525586-67525608 CCTGCTTTGCAGCCAGCTGCAGG - Intergenic
1160679967 19:408073-408095 CCAGCTTGGCAGGCAGCCGGGGG + Exonic
1161455364 19:4367156-4367178 CCTGCTCTGCAGGCAGCGTGTGG - Intronic
1161587380 19:5113085-5113107 CCTTCTTTGCACGCAGGAAGTGG + Intronic
1162099255 19:8329943-8329965 CCTGCTTTGCAGCAAGGATTAGG + Intronic
1162432354 19:10636591-10636613 CTGGCGTTGCAGGCAGGATGGGG + Intronic
1163125481 19:15242166-15242188 CTTGATTTGCAGGCAGCACCCGG + Intronic
1163394161 19:17049314-17049336 CCTGCCTTGCTGGCAGCTTCGGG - Intergenic
1164574452 19:29397603-29397625 CCAGCTCTGCAGGAAGCATGAGG - Intergenic
1165447998 19:35867269-35867291 AGTGCTTTGCAGGTAGCAAGAGG - Intronic
1165715999 19:38046296-38046318 CCATCTTTGCGGGCAGCAGGTGG - Intronic
1167670550 19:50850597-50850619 ACAGCTTAGCAGACAGCATGAGG + Intergenic
1168397447 19:56060902-56060924 GCTGCCTTGAAGCCAGCATGGGG - Intronic
925270884 2:2606590-2606612 TCTGCTGTGCAGGAAGCATAGGG - Intergenic
925294256 2:2767279-2767301 CCTGGTGTCCAGGCTGCATGGGG - Intergenic
925931201 2:8709491-8709513 CCTGCTGTGCAGGCAGGAGCAGG + Intergenic
926059362 2:9795545-9795567 CCTGCTGAGCAGCCAGCATGAGG - Intergenic
926128215 2:10284786-10284808 CCAGGTATGCAGGCAGCAGGTGG - Intergenic
926157341 2:10463901-10463923 CCTGCTTTTCAGGGGGCCTGTGG + Intergenic
926797047 2:16627759-16627781 GCTGCTGTGCAGGCAGAATTAGG + Intronic
927875787 2:26654305-26654327 CCAGCTTGGGAGGCAGAATGGGG + Intergenic
928603072 2:32920386-32920408 ATTGCTTTGCAGTCTGCATGGGG - Intergenic
928885745 2:36146336-36146358 CATTCTTTGCAGGCCTCATGGGG - Intergenic
930605699 2:53490811-53490833 GCTGCTTTGCAGGCAGACAGAGG - Intergenic
931748376 2:65310045-65310067 CCTGTCTTGCAGGGAGCATGAGG + Intergenic
935830624 2:106997672-106997694 CCTGCTGTGCAGGAAGCAGTTGG + Intergenic
937916642 2:127102560-127102582 CCTACTTGGGAGGCTGCATGGGG - Intronic
937979787 2:127608272-127608294 GCTGCTTTGCAGGCAGCTGGGGG - Intronic
938097966 2:128475610-128475632 GCTGCTTGGCAGGGAGCAGGAGG + Intergenic
938248148 2:129794696-129794718 TCTGCTTTGCATGCAGACTGAGG + Intergenic
938324673 2:130390682-130390704 CCTGCTTGGCAGGGAGCAGCTGG - Intergenic
939705171 2:145443966-145443988 CCTGCTGTGCAGAAATCATGGGG - Intergenic
941721038 2:168813212-168813234 CCTGCTCTGCAGGCAGAAGGTGG - Intronic
943504374 2:188734887-188734909 GCAGTTTTGCAGGCTGCATGTGG + Exonic
945155307 2:206831732-206831754 CCTGCTTTACAGGGAGCAGCAGG - Intergenic
946289856 2:218736308-218736330 CCTGCTTTCATGGCAGCATCTGG - Intronic
946353902 2:219172907-219172929 GCTGCCTGGAAGGCAGCATGGGG - Exonic
946614714 2:221497110-221497132 CCTGCTGTGGAGGCAGTTTGGGG + Intronic
946715873 2:222554765-222554787 CCTGCTTTGCAGACAGCAGCGGG + Intronic
948915805 2:241034562-241034584 CCTGCGTTGAAGCCAGCCTGGGG - Exonic
948932759 2:241142601-241142623 GCTTCTTTTCAGGCAGCAGGTGG - Intronic
1171108972 20:22463145-22463167 CCTGCTTTTCAGCCGGCATAGGG + Intergenic
1172274220 20:33670999-33671021 CCTACTTTGCAGGCACCAAAGGG + Intronic
1173189505 20:40865302-40865324 CCTGCTCTGCAGGCCCCTTGGGG - Intergenic
1174610481 20:51794156-51794178 CCTGCTTTGCACGCAGTAGGAGG - Intronic
1175148928 20:56917652-56917674 GCTGCTTTGCAGGCTACAGGTGG - Intergenic
1176075990 20:63248417-63248439 CCTGCATTGCAGGAGGCACGAGG + Intronic
1177348299 21:19900951-19900973 CCAGCTTTGCAGGCTGGTTGAGG + Intergenic
1178244722 21:30939393-30939415 CCTGCTTTGTAGTGAGAATGAGG + Intergenic
1178773166 21:35524659-35524681 CCTGCTCTGTACTCAGCATGGGG + Intronic
1179610019 21:42544301-42544323 CCTACCTGGCAGGCAGCATGAGG - Intronic
1179920919 21:44506900-44506922 GCTGCTTTGGAGGCAGAATCGGG - Intronic
1182996074 22:34813504-34813526 ACTGCACTGCAGCCAGCATGGGG + Intergenic
1183737811 22:39653576-39653598 CCTGCAGGGGAGGCAGCATGGGG + Intronic
1185324436 22:50218807-50218829 CCTGCAGTGCAGCCTGCATGGGG - Exonic
949190786 3:1245992-1246014 CCTGGGTTGCATGCAGCCTGAGG + Intronic
950522465 3:13505216-13505238 CCTGGTTCCCAGGCAGCAGGTGG + Exonic
952413334 3:33068716-33068738 CCTGCATTCCAGAGAGCATGGGG - Intronic
952742317 3:36746588-36746610 TCTGGTTTGCATGAAGCATGAGG - Intergenic
953919766 3:46943778-46943800 CTAGCTCTGCAGACAGCATGAGG + Intronic
954539456 3:51384320-51384342 CCTGCCTTCAAGGCAGGATGCGG - Intergenic
956745889 3:72310828-72310850 CCTGCCTTGCAGGCACTCTGGGG - Intergenic
959084318 3:101834890-101834912 CATTGTTTGCAGGCAGCATCAGG + Intronic
959259689 3:104060941-104060963 ACAGCATTGCAAGCAGCATGAGG - Intergenic
961397512 3:126606287-126606309 CCTGCTTTGCACTGAGCATGGGG - Intronic
961646414 3:128395058-128395080 CCTGTGCTGCTGGCAGCATGGGG + Intronic
962156282 3:132952195-132952217 CATGTTTTAAAGGCAGCATGAGG - Intergenic
962964533 3:140341373-140341395 TCTGCAAGGCAGGCAGCATGGGG - Intronic
964867983 3:161282567-161282589 CTTGCTGTGCAGGCAGCCGGGGG + Intergenic
968264601 3:197353186-197353208 CCTGCCTTCCAGGCAGCAGGTGG - Intergenic
968315694 3:197723111-197723133 TTTGCTTTGTAGTCAGCATGAGG + Intronic
969273019 4:6115820-6115842 CCGGCCTCGCAGGCAGGATGGGG + Intronic
969578626 4:8050976-8050998 CCTCCTCTGCTGGCAGCATCCGG + Intronic
972075893 4:35086630-35086652 CCTTGTTTTAAGGCAGCATGAGG + Intergenic
976117524 4:81743946-81743968 CCTGCTTCAAAGGCAGCAAGAGG + Intronic
979227563 4:118306408-118306430 CAGGCTTTACAGGAAGCATGGGG + Intronic
980117164 4:128690634-128690656 ACTACTTTGCAGGCAACAAGTGG - Intergenic
981643317 4:146969603-146969625 TCTTCTTTGCAGGAAGAATGGGG - Intergenic
982766815 4:159358258-159358280 CCTGCCTTAAAAGCAGCATGGGG + Exonic
983045859 4:162985359-162985381 CCTGCCTTGCTGGCAGCTTCGGG - Intergenic
983523046 4:168730753-168730775 CATGCTTGGCAGACAGCATTTGG + Intronic
983735857 4:171059067-171059089 ACTGCTTTGAAGCCAGCATGGGG + Intergenic
985217117 4:187665612-187665634 CCTGATTTGTAGACTGCATGTGG - Intergenic
985979449 5:3450358-3450380 CGTGCATTGCAGAGAGCATGGGG + Intergenic
989583095 5:43051876-43051898 CCTGGTTTGCAGTTTGCATGAGG - Intergenic
989754248 5:44933737-44933759 TTTGCTTTGCAGTCGGCATGAGG + Intergenic
990409236 5:55524341-55524363 CCTGGGTTGCATGCAGCCTGTGG + Intronic
991376342 5:65971977-65971999 ACAGCTTGGCAAGCAGCATGTGG - Intronic
991925167 5:71698264-71698286 GCTGCTTTCCAGGAAGCATGTGG - Intergenic
997297940 5:132780051-132780073 TCTGCATTCCAGGCAGCAAGAGG + Intronic
997481793 5:134190787-134190809 CCTGATTTTCAGGAAGCATTAGG - Intronic
997784982 5:136702002-136702024 TGTGCTTTGTAGGCAGCAGGTGG - Intergenic
998409329 5:141897264-141897286 CCTGGTTTGCAGTTTGCATGAGG - Intergenic
1002271430 5:178075204-178075226 TGTGCTTTACAGGCAGAATGGGG - Intergenic
1005111868 6:22290945-22290967 ACTGCTCTGCCAGCAGCATGGGG - Intronic
1005814698 6:29541152-29541174 CCCATTTTGGAGGCAGCATGTGG + Intergenic
1006454384 6:34123582-34123604 CCAGCTCTGGAGGCGGCATGTGG - Intronic
1007313572 6:40966093-40966115 CCTGCTTTTCTGGCAGTATGTGG - Intergenic
1008688003 6:53945780-53945802 CCTGCTTGCCAGGCAGCTTCAGG + Intronic
1010885749 6:81238011-81238033 CCTGCATTACAGAAAGCATGTGG + Intergenic
1011342846 6:86336454-86336476 CCTTCTCTACAGGCAGCAGGAGG - Intergenic
1012219469 6:96630878-96630900 CATGCTTTGCAGGAAGAATGAGG - Intergenic
1013456669 6:110335903-110335925 CCTGGGTTGGAGGCAGCATGGGG - Intronic
1013644493 6:112123129-112123151 CCTGCTTTGAAAGCAGGATGAGG - Intronic
1015102812 6:129501259-129501281 CCTCTTTTAGAGGCAGCATGTGG - Intronic
1016802783 6:148183441-148183463 CTTGCTTTGCAGTCAGTGTGAGG - Intergenic
1017489279 6:154930519-154930541 CCTGCTTCCCCGGCAGCCTGGGG - Intronic
1017739947 6:157397971-157397993 CCAGCCTGGAAGGCAGCATGGGG + Intronic
1018888954 6:167966989-167967011 CCTGCTCTACAGTCAGCATAGGG - Intronic
1021759196 7:23886854-23886876 TCTGATTTCCAGGCAGCATCAGG + Intergenic
1022826614 7:34020803-34020825 CCTGCTTTGCAGGCAGCATGGGG + Intronic
1026793171 7:73348421-73348443 CCTGCTATACAGGGAGGATGTGG - Intronic
1026895178 7:74006288-74006310 GCTGCCTTGCAGGCAGGACGAGG + Intergenic
1029339771 7:99933420-99933442 CCTGCTTTTCAGGGACCCTGTGG + Intergenic
1029573471 7:101387036-101387058 CCTGCTTTGCTGACAGCGGGTGG + Intronic
1030847799 7:114442895-114442917 ACTTCTTTGCATGCAGCAAGTGG + Intronic
1031132859 7:117853132-117853154 CATGCTTTGCAGGAATCCTGAGG - Intronic
1031288288 7:119900365-119900387 CAAGCTCTGCAGTCAGCATGTGG + Intergenic
1031310218 7:120187037-120187059 ACTGCATTGAAGCCAGCATGGGG + Intergenic
1031855008 7:126911856-126911878 CCAGCTATGTGGGCAGCATGTGG - Intronic
1031961677 7:127995716-127995738 ACTGCTGTGCAGGCAGCAACTGG - Intronic
1033090486 7:138381148-138381170 CCAGCTTTGGCGGCAGAATGAGG - Intergenic
1033223077 7:139541673-139541695 CCTGATTTGCAGGAAGCTTGGGG - Intronic
1033532555 7:142279849-142279871 CATGCTTTGCAGGCAGCTGGTGG - Intergenic
1033756662 7:144402217-144402239 CCTGCTTTGCAGGGAGGGGGAGG - Intronic
1034514842 7:151567824-151567846 CCTGCCCTGGAGGCAGCTTGAGG - Intronic
1035339414 7:158150994-158151016 CCCGCATAGGAGGCAGCATGAGG - Intronic
1037374437 8:18212624-18212646 CCTCCTTTGCAGAGAGCAAGAGG - Intronic
1037480866 8:19303958-19303980 CAGGCTTTGCAGGAAGCATGGGG + Intergenic
1037721340 8:21446971-21446993 GCTGCTTTGCAGCCCACATGAGG + Intergenic
1037876114 8:22549368-22549390 CCAGCTGTGGAGGCAGCAAGGGG + Intronic
1038048594 8:23788582-23788604 CCTGCTTTGCAGTCATTTTGTGG - Intergenic
1038331476 8:26612862-26612884 GCTGCTGTGCAGACAGAATGTGG - Intronic
1038616919 8:29104005-29104027 CATGCTTCGGAGACAGCATGGGG - Intronic
1039819705 8:41124842-41124864 CCTGGTCTGCATGCAGCCTGCGG - Intergenic
1041016143 8:53594667-53594689 CCTGATTTCCCGGCCGCATGGGG - Intergenic
1041334855 8:56770431-56770453 CCTCCTTTGCTGGAGGCATGAGG + Intergenic
1041404189 8:57479705-57479727 CCTGTTTTGCAGGCAACCTACGG - Intergenic
1042877314 8:73451057-73451079 CAGGCTTTGCCGGCAGCGTGTGG - Intronic
1046092788 8:109522968-109522990 CCTGGTGTGCTGGCAGCCTGAGG + Intronic
1046271149 8:111899153-111899175 CCTGCTGGGCGGGGAGCATGAGG - Intergenic
1046875118 8:119246347-119246369 CCTGCTAGGCAGGCAGCACTGGG - Intergenic
1047439773 8:124867310-124867332 CCAGCTTTGAAGGCAGGAAGAGG - Intergenic
1049032475 8:140047923-140047945 CCTGCCTTGCTGGCAGCTTGTGG - Intronic
1049092901 8:140530273-140530295 GCTGCTTTGGAGGCAGCAGGAGG - Intergenic
1049818668 8:144621000-144621022 CCTGCTTTGCAGGAGGCACATGG + Intergenic
1052172357 9:25415549-25415571 CCTCCTTTGAATGCAGCATTTGG - Intergenic
1052174081 9:25435303-25435325 CCTTCTTCACAGGCAGCAGGAGG + Intergenic
1052234445 9:26192983-26193005 TATGATTTCCAGGCAGCATGGGG + Intergenic
1053151618 9:35747425-35747447 CCAGATGTGCAGGCAGCATCAGG + Intronic
1053438234 9:38091837-38091859 TCTGATTAGCAGGCAGCCTGTGG - Intergenic
1056578398 9:87872760-87872782 CCTGCTCAGGAGGCAGCATCAGG - Intergenic
1056869205 9:90261276-90261298 CCAGCTATGCAGAGAGCATGTGG - Intergenic
1057276895 9:93680844-93680866 CCAGCTTCCCAGGCAGCCTGGGG - Intergenic
1057842149 9:98495015-98495037 GCTGCTCTGCAGGAAGCATCTGG - Intronic
1058742015 9:107953107-107953129 CCTAATTTGCAGGCAGGATTGGG + Intergenic
1059154879 9:111980822-111980844 CGTGCTTGCCAGGCAGCCTGAGG + Intergenic
1059285712 9:113169750-113169772 CCTGCTCTGAGGGCACCATGGGG + Exonic
1060906936 9:127315038-127315060 ACTGCTGTGAAGGCAGCATAGGG + Intronic
1061204696 9:129156221-129156243 CCTTCCTTGAAGGCAGGATGAGG + Intergenic
1061592854 9:131609212-131609234 TCTGCCTAGCAGGAAGCATGAGG - Intronic
1061762029 9:132857776-132857798 CCTGCTGTGCAGGCTGCAGGGGG - Intronic
1062564826 9:137159508-137159530 CCTGCTCTGCAGACAGGGTGGGG + Intronic
1062623938 9:137434598-137434620 CCCTGTTTGCAGGCAGCATGTGG + Exonic
1186407864 X:9319497-9319519 CCTGAATTGCACGCAGCCTGAGG + Intergenic
1186436101 X:9544272-9544294 CCCGCTTTCCAGACACCATGGGG - Intronic
1186901244 X:14059228-14059250 CCTTCTTTGAAGCAAGCATGCGG + Intergenic
1188537796 X:31216601-31216623 CTTGCTGTGGAGGCAGCCTGTGG + Intronic
1189325228 X:40107623-40107645 CCGCCTCTGCAGGCAGCCTGGGG + Intronic
1191754892 X:64582339-64582361 CCTGCTTTGCAGGATGGCTGAGG + Intergenic
1192003601 X:67185051-67185073 CATGCTTTGGGGGAAGCATGGGG - Intergenic
1194665801 X:96676145-96676167 CCTGTTTTGAAGGCAGCAGAAGG + Intergenic
1196122814 X:112068650-112068672 CCTGCATTGCTGGGACCATGTGG + Intronic
1202257401 Y:22936399-22936421 CCTGCTTTGCCAGCAGCAGAGGG - Intergenic
1202410391 Y:24570146-24570168 CCTGCTTTGCCAGCAGCAGAGGG - Intergenic
1202460390 Y:25099926-25099948 CCTGCTTTGCCAGCAGCAGAGGG + Intergenic