ID: 1022829387

View in Genome Browser
Species Human (GRCh38)
Location 7:34049954-34049976
Sequence TAGACAGAAGTGATTATAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022829385_1022829387 -4 Left 1022829385 7:34049935-34049957 CCTAAAACTAAGGTGCAATTAGA 0: 1
1: 0
2: 0
3: 10
4: 171
Right 1022829387 7:34049954-34049976 TAGACAGAAGTGATTATAATGGG 0: 1
1: 0
2: 3
3: 18
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022829387 Original CRISPR TAGACAGAAGTGATTATAAT GGG Intronic
902156976 1:14495618-14495640 TTGACAGAAGTGATTATATTAGG + Intergenic
904148572 1:28416597-28416619 TAGTCAGAAGTGATAAAAAGTGG - Intronic
906450062 1:45937842-45937864 TACACTGAAGAGATTACAATAGG - Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
907819459 1:57952927-57952949 TAGGGAAAAGTGATTATGATCGG - Intronic
909823908 1:80101013-80101035 TAGACAGAAGTAGATATTATAGG - Intergenic
909932435 1:81512646-81512668 TAGATAGAAATGATAATAAATGG - Intronic
910131461 1:83912270-83912292 TAGAAACAAGTGATTCTAATAGG - Intronic
910308933 1:85801123-85801145 CTGAAAGGAGTGATTATAATAGG - Intronic
910568496 1:88674392-88674414 AACACAGGAGTGAATATAATTGG + Intergenic
910695949 1:90015868-90015890 TAGATTGAAGTGACTCTAATGGG + Intronic
911355250 1:96809728-96809750 CAGACAGAAGTTATTTTAATGGG + Intronic
913415864 1:118606282-118606304 AAGACAGCAGTGAATATAAATGG - Intergenic
917140939 1:171835045-171835067 TGGACAGAAGTGATTGGGATAGG + Intergenic
917875554 1:179283624-179283646 TAGGGAAAAGTGATTTTAATAGG - Intergenic
918556862 1:185812162-185812184 AAGATATAAGTGATTATAAAAGG + Intronic
918650767 1:186960087-186960109 TAAACAGAAGAAATTATAATAGG + Intronic
919080895 1:192864693-192864715 GGGACAGAAGTGTTTATATTAGG - Intergenic
919416600 1:197318307-197318329 TTGACAGTAGTCATTCTAATTGG - Intronic
920121605 1:203662956-203662978 TAGAGAGAAGTGATTATCTGGGG + Intronic
920914045 1:210244792-210244814 TACAGAGAAGTGATTCTAGTGGG - Exonic
921195876 1:212757280-212757302 TAGACCAAAGGAATTATAATGGG + Intronic
1065301447 10:24325215-24325237 TTGACAGTAGTGGTTATACTGGG + Intronic
1065408674 10:25397171-25397193 CAAACAGAAGTGATTATACAGGG + Intronic
1069230144 10:65998428-65998450 TGGACAGAAGTGGTTGTAAATGG - Intronic
1069287866 10:66739150-66739172 GATCCAGAAGTGATTAGAATGGG - Intronic
1071833245 10:89393032-89393054 CAGACAGAAGTGAATCTGATGGG - Intronic
1071855382 10:89619108-89619130 TAGACAGAAATAAATATAACAGG - Intronic
1073172872 10:101527102-101527124 TTGACAGAAAAAATTATAATAGG + Intronic
1075769431 10:124920275-124920297 CAGACACAAGAGATTATTATTGG - Intergenic
1076352609 10:129828223-129828245 AAGCCAGCTGTGATTATAATAGG + Intergenic
1076896554 10:133315982-133316004 TAGCTAGAAGTGTTTAAAATGGG + Intronic
1079799098 11:24846059-24846081 TAAATAGAAGTGGATATAATAGG - Intronic
1079934636 11:26601749-26601771 TAGACAGAGGTTATTGCAATTGG + Intronic
1079947126 11:26758084-26758106 AAGACAGAGGAGATTGTAATGGG + Intergenic
1080240718 11:30124177-30124199 AGGACACAAGTGATTAAAATTGG + Intergenic
1080703688 11:34667996-34668018 AAGACAGAAGTGATGATTAATGG - Intergenic
1081124500 11:39306407-39306429 TAGTGAGAATTGATTATAAGTGG + Intergenic
1088766534 11:112985949-112985971 TAAACAGAAGTGGTAAGAATAGG + Intronic
1089043604 11:115479027-115479049 TAGACTGAAGTGATTTTGTTTGG + Intronic
1090177146 11:124660861-124660883 TAGCCACAAATGAGTATAATTGG - Intronic
1090581938 11:128170250-128170272 TAGACAGAAGTGTGAATCATGGG + Intergenic
1090993030 11:131837961-131837983 CAGACAGAAGTTAATATATTAGG - Intronic
1093152349 12:15637331-15637353 TAGAGAATAGTGATTATAAAAGG - Intronic
1093598713 12:20995005-20995027 TAGAAAGCAGTGATTATCAGAGG + Intergenic
1095801141 12:46270227-46270249 TAGACAGTAGTCATTGTATTTGG + Intergenic
1098107090 12:67080164-67080186 TAGAAAGCAGAGATTACAATTGG - Intergenic
1098242409 12:68481589-68481611 CAGAAAAAAGTGATGATAATTGG - Intergenic
1098828420 12:75329515-75329537 CCGAGAGAAGTGATAATAATTGG - Intronic
1099671290 12:85696636-85696658 TAAACAAAAGTGATTATAGTTGG + Intergenic
1102103096 12:110296273-110296295 GAGACAGAATTGATTTTAAATGG + Intronic
1103754174 12:123190090-123190112 AAGACAGAAGTGATCAGAAAAGG + Intronic
1106210785 13:27642531-27642553 TAGACAGAATAGATGATGATGGG - Intronic
1106693455 13:32145248-32145270 TATATAGAAAGGATTATAATCGG + Intronic
1108250004 13:48555730-48555752 TAGAGAAAAGTGATGGTAATAGG - Intergenic
1110784608 13:79509381-79509403 TAGAAAGAAGTTATGATAAGAGG + Intronic
1110930385 13:81208118-81208140 TAAAGAGAAGTGATTAAAAAAGG - Intergenic
1111711728 13:91824261-91824283 CAGAAAGATGAGATTATAATTGG + Intronic
1111728569 13:92043435-92043457 TATACAAGAGTGATTGTAATGGG + Intronic
1111938674 13:94585422-94585444 TAGTCAGTAGTCATTATATTAGG - Intronic
1111994331 13:95149300-95149322 TAGACAGAAGTATTTCTTATTGG - Intronic
1113858331 13:113462493-113462515 TAAACAGAAGTTATTAAAGTTGG + Intronic
1113979023 13:114256608-114256630 TGCATAGAACTGATTATAATGGG + Intronic
1114211462 14:20619076-20619098 CACACAGGAGTGTTTATAATGGG - Intergenic
1114716257 14:24828428-24828450 AAAACAAAATTGATTATAATTGG + Intronic
1115763605 14:36600454-36600476 TAGAAAGAAGAAATTTTAATAGG + Intergenic
1116625621 14:47259203-47259225 GAGATAAGAGTGATTATAATGGG + Intronic
1116647717 14:47550801-47550823 TAAACAGAACTGATTATAACTGG - Intronic
1118185717 14:63536343-63536365 TTGATAGTAGTCATTATAATAGG - Intronic
1119630808 14:76230240-76230262 AAGACAGAAGTGATGTCAATTGG + Intronic
1120580048 14:86235961-86235983 TGGACAAAAGTGATTTTAACTGG - Intergenic
1202874958 14_GL000225v1_random:198642-198664 TAGAAAGGATTGAATATAATGGG + Intergenic
1125704268 15:41718863-41718885 TAAACAGAAGTGGTAAAAATGGG - Intronic
1126248071 15:46533876-46533898 TAAATAGAAGTGATGAAAATGGG + Intergenic
1126515658 15:49534079-49534101 TAGACTGTTGTAATTATAATAGG - Intronic
1127156442 15:56131245-56131267 TAGAAATAAGAGATTATATTAGG + Intronic
1127327725 15:57911815-57911837 CAAACAGAAGTGCTTATAAAAGG + Intergenic
1130312942 15:82770895-82770917 TACACAGAAGTCATTGTATTGGG - Intronic
1131321538 15:91397834-91397856 GACACAGAAGTGATTATAAAGGG - Intergenic
1133492152 16:6280648-6280670 TAGCCAGAAGTAATTAAGATAGG + Intronic
1134064782 16:11221019-11221041 TAGCCAGAGTTGATAATAATAGG - Intergenic
1144666052 17:17102931-17102953 CAGACAGAAGTGGTTACAAACGG - Intronic
1149119708 17:53147661-53147683 TAGAGAGAAGTGAATAAATTGGG + Intergenic
1150571013 17:66387390-66387412 GAGAGAGAAGTGAGTATAAGAGG + Intronic
1151020641 17:70613111-70613133 AAGACAGAAGTGTTTATATCGGG + Intergenic
1152364605 17:79848176-79848198 TTGACAGTAATGATGATAATGGG + Intergenic
1153049502 18:887922-887944 TAGACAGAAGTGATTAATCATGG - Intergenic
1153617575 18:6948580-6948602 TAGACAGTGGTGATTCTAATGGG + Intronic
1153967231 18:10192807-10192829 TAGACAGCAGTTAGTATTATTGG + Intergenic
1155612571 18:27683368-27683390 AAGACACAAGTCATTAGAATAGG + Intergenic
1156611634 18:38731889-38731911 CAGAGAGAAGTAATTATAAAGGG + Intergenic
1156660476 18:39340391-39340413 TAGAAAGAAGTCATCAGAATAGG - Intergenic
1156919674 18:42505612-42505634 TACACATAAGAGATTATACTAGG - Intergenic
1158705349 18:59787756-59787778 TAGACAGAAATATTTACAATTGG + Intergenic
1160130394 18:76219987-76220009 TAAACATCAGTAATTATAATAGG + Intergenic
1163957521 19:20658225-20658247 CAGACAGATGAGATTATAACCGG + Intronic
926787329 2:16531115-16531137 TTGTCTGAAGTGATTATAAATGG + Intergenic
933283997 2:80364773-80364795 GACACAGAGGTGATTATAAAAGG - Intronic
933316476 2:80721189-80721211 TACACAGATGTTATTGTAATGGG - Intergenic
935537716 2:104313755-104313777 TATACAGAAGTTATTAAAAGTGG - Intergenic
939269599 2:139920799-139920821 CCCACAGAAGAGATTATAATAGG - Intergenic
939703931 2:145428838-145428860 CAGACAGATGTGGTTATAAGGGG + Intergenic
940246560 2:151624618-151624640 TAGGCAAAAGTAATTATTATGGG + Intronic
940584111 2:155622371-155622393 TAGGCAAAAGTACTTATAATGGG + Intergenic
941138715 2:161749309-161749331 TAAATAGAAGTGATGAGAATGGG + Intronic
941625054 2:167822312-167822334 TAAACAGAGCTGGTTATAATAGG + Intergenic
943506501 2:188766946-188766968 TAGACAAAAGGAATTATCATTGG - Intronic
944545343 2:200793656-200793678 CACACAGAAGTAATTATAAATGG - Intergenic
945113969 2:206392759-206392781 GAGACAGAACTGATTGTAGTAGG + Intergenic
945632988 2:212306867-212306889 AAGACATAAGTAATTTTAATTGG - Intronic
945865351 2:215168412-215168434 AAAACAGAAGAGATTATCATAGG + Intergenic
1170164222 20:13345209-13345231 TAAACAGAAGTAAAAATAATTGG - Intergenic
1173039528 20:39448943-39448965 TAGACAAAAGTGACAATGATAGG - Intergenic
1177049718 21:16217868-16217890 TATACAGTGGTGATTATTATAGG - Intergenic
1177484683 21:21742300-21742322 TAGATAGATGTGGTTATATTTGG + Intergenic
1177793992 21:25753643-25753665 TAGACAGAAGTAACTAGAGTTGG + Intronic
1182503546 22:30765818-30765840 TAGACAGAAGTGGTTTTCTTAGG - Intronic
950588849 3:13920198-13920220 TAAATAGAAGTGGTGATAATGGG + Intergenic
950748654 3:15111043-15111065 AAGAAAGATGTGATTACAATTGG + Intergenic
951674596 3:25222951-25222973 AAGACAGAAGTGATATTAAACGG - Intronic
955552694 3:60101127-60101149 TATACAGAAAGGATTAGAATAGG - Intronic
957164365 3:76652192-76652214 CTGATAGAAGTGATTAAAATTGG - Intronic
957887702 3:86311164-86311186 TGAATAGAAGTGATTAGAATGGG + Intergenic
957957590 3:87208650-87208672 TGGGCAGAAGTGGTTATAGTGGG - Intergenic
958005758 3:87809674-87809696 TAGACAAATGTGATTATAGAGGG - Intergenic
959940882 3:112079724-112079746 AAGACAGAAGTCATTATTATAGG - Intronic
963000348 3:140674989-140675011 TACACAGAAGTCAATATAAATGG + Intergenic
963118273 3:141752678-141752700 TAGAAAGAGTTGATAATAATAGG - Intergenic
966075334 3:175929845-175929867 TAGAGAGATGTGAGTATGATGGG - Intergenic
966437840 3:179908426-179908448 TAGAGAGAAGAGTTTATAAAAGG - Intronic
967233504 3:187363573-187363595 TAGACAAGAGTGATAAGAATTGG - Intergenic
971436004 4:26624508-26624530 TATACAGAAATTACTATAATAGG - Intronic
972043795 4:34638809-34638831 TACAGAAAAGTGAGTATAATAGG + Intergenic
972802232 4:42488995-42489017 TAATCAGAAGTGATAATAAAGGG - Intronic
974436876 4:61867923-61867945 TAAAGAGAAGGGCTTATAATGGG + Intronic
974757341 4:66227331-66227353 TGAACAGAAATGATTATACTGGG + Intergenic
976145322 4:82037152-82037174 TAGACAGATGTAATCATAATGGG + Intronic
976554707 4:86436840-86436862 TAAATAGAAGTGATGATAAAAGG + Intronic
976822426 4:89221457-89221479 TAGAAAGAACTGATGATAATGGG + Intergenic
977038742 4:91986816-91986838 CAAATAGAAGTAATTATAATAGG - Intergenic
977475141 4:97497279-97497301 TATAGTGAAATGATTATAATTGG - Intronic
977993199 4:103469775-103469797 TAGTCAGAAAGGATTAAAATAGG + Intergenic
978095204 4:104768231-104768253 TAAAAAGAAGGGAGTATAATTGG + Intergenic
979693476 4:123585450-123585472 TAGATAGCAGTTATTAGAATAGG - Intergenic
980097571 4:128507984-128508006 TAAATAGAAGTGATTATAATGGG + Intergenic
980562545 4:134496832-134496854 GAGATAGGAGTGATTATAAAAGG - Intergenic
981078786 4:140617767-140617789 TAGACACAAGTGAGTAGAGTAGG - Intergenic
983527052 4:168770133-168770155 TAGAAAGAAATCATTATAATTGG - Intronic
984545543 4:181097571-181097593 TAGACAGAAATGATCACACTTGG - Intergenic
985179953 4:187249047-187249069 TAGACAGAATTGAATATCTTGGG - Intergenic
988316295 5:29633898-29633920 TAAATGGAAGTGATTATAAAAGG + Intergenic
989368805 5:40683320-40683342 TAAACAGAAGTAAATATAATAGG + Intronic
989446730 5:41538435-41538457 TAGACATTAGTGATCAAAATAGG - Intergenic
991066030 5:62425794-62425816 TATATAGAAGTGTATATAATAGG + Intronic
993247726 5:85472314-85472336 TAGACATAAGCCATTATAATTGG + Intergenic
993804291 5:92384923-92384945 TATAAAGAAATGATTATATTGGG + Intergenic
994046284 5:95313994-95314016 TAGACAGACTAGATTAAAATGGG - Intergenic
995133949 5:108660386-108660408 TAGACAGAATTGATCCCAATGGG + Intergenic
996238543 5:121165808-121165830 TATATAGGTGTGATTATAATCGG + Intergenic
996361048 5:122647087-122647109 TTGACAGTAGTCATTATAACAGG - Intergenic
996677930 5:126197944-126197966 AAGAGAGAAGTCATTAAAATTGG - Intergenic
1003515851 6:6818246-6818268 CAAACAGAAGTGAATATGATGGG - Intergenic
1004242301 6:13935793-13935815 TAGACATCACTTATTATAATGGG + Intronic
1004404224 6:15317034-15317056 TAGACAGTCTTGAGTATAATGGG + Intronic
1005909341 6:30294473-30294495 TGGACAGAAGTCATGATGATGGG + Intergenic
1007683468 6:43650297-43650319 TAGACAGAAGGGAAGATAATAGG + Intronic
1009898792 6:69785660-69785682 TAGAGAAAAATGATTAAAATTGG - Intronic
1012037472 6:94161005-94161027 TAGACAAATGGGATTATACTGGG + Intergenic
1013346230 6:109263284-109263306 TAAACAGAAGTTATTAGAGTGGG + Intergenic
1014166050 6:118226173-118226195 TTGACAAAAGTCATTATAACTGG - Intronic
1014760194 6:125347558-125347580 TAAATAGTAGTGATTATAACAGG - Intergenic
1014881904 6:126733818-126733840 TTTAAATAAGTGATTATAATTGG + Intergenic
1016000750 6:139038754-139038776 TAGAGGGAAGTGATTAACATGGG + Intronic
1016192266 6:141284671-141284693 TAGACAGATGGGATTTTAATAGG + Intergenic
1016852423 6:148634660-148634682 TAGACAGAAATTATTAGAACTGG - Intergenic
1017620266 6:156289389-156289411 TAGACACAAGTTTTTATCATTGG - Intergenic
1019040990 6:169105139-169105161 GGGAAAGAAGTGATTTTAATGGG + Intergenic
1020613587 7:10430647-10430669 CAAACAGAAGTGATTAATATGGG + Intergenic
1020946591 7:14617070-14617092 TAGAGAGAAGTGATTGAACTGGG - Intronic
1021316058 7:19148326-19148348 TAAACAGAAGTGTTTATCCTGGG - Intergenic
1022829387 7:34049954-34049976 TAGACAGAAGTGATTATAATGGG + Intronic
1024039241 7:45537130-45537152 TAGACAGACATTATTAAAATTGG - Intergenic
1024950630 7:54856728-54856750 TAAACAGAAGTGATGAGAGTGGG + Intergenic
1026389998 7:69891123-69891145 TAGGAAGAAGGGATTATAAAGGG - Intronic
1026433715 7:70374604-70374626 AAAAGAGAAGTGATTATATTGGG + Intronic
1027990265 7:85350536-85350558 TAGACAGCAGTTAATATTATAGG + Intergenic
1028075263 7:86504988-86505010 TATAAAGAAGAGATAATAATAGG + Intergenic
1028957993 7:96715092-96715114 TAGACAGAATGGACTATAACAGG + Intergenic
1028957998 7:96715164-96715186 TAGACAGAATGGACTATAACAGG - Intergenic
1029344648 7:99969808-99969830 TAGAAAGAAGTGATCAGATTAGG - Intronic
1030078044 7:105753556-105753578 TTGACACAAGTGACTAAAATGGG + Intronic
1030219666 7:107084596-107084618 TAGATGGTAGTCATTATAATAGG - Intronic
1032224420 7:130019535-130019557 TAGCCAGCAGTGCTAATAATAGG + Intronic
1032611294 7:133417781-133417803 TTGAAACAAGTCATTATAATTGG + Intronic
1032886143 7:136140907-136140929 TAGAAAGAAGTAATTACAAATGG + Intergenic
1033176783 7:139131908-139131930 AAGACAGAAGTGAATCTAAGTGG - Intergenic
1033858523 7:145595558-145595580 TAGACAAAAATGAGTAAAATGGG - Intergenic
1034608812 7:152345495-152345517 AAGACAGAAATTGTTATAATAGG + Intronic
1035592777 8:829801-829823 TATACTGCAGTTATTATAATAGG - Intergenic
1037931904 8:22886211-22886233 AAGACAGAAGTGATCAGAAGCGG + Intronic
1040777245 8:51060318-51060340 AAGACTGATGTGATTATAAAGGG - Intergenic
1041136197 8:54761948-54761970 GAGACAGAAGTAACTATAAGTGG - Intergenic
1041529456 8:58847652-58847674 TAGACAGAAATGATTACAATCGG + Intronic
1043817095 8:84814326-84814348 CCAACAGAAGTTATTATAATGGG + Intronic
1043833481 8:85017520-85017542 TGGACAGATGAAATTATAATGGG - Intergenic
1046985650 8:120385216-120385238 TGAACAGAAGTGATAAAAATGGG - Intronic
1049056338 8:140240264-140240286 GGGACAGAAGAGATTCTAATGGG + Intronic
1055700531 9:78940145-78940167 GAGACAGAAGAGCTTATAAAGGG + Intergenic
1056151037 9:83788447-83788469 TACCAAGAAGTGTTTATAATAGG - Intronic
1186731250 X:12412554-12412576 TATCCAGAAGTGATTATCTTAGG - Intronic
1188024836 X:25197359-25197381 GAGGGAGAAGGGATTATAATAGG + Intergenic
1194110033 X:89822660-89822682 TAAATAGAAGTGATTAGAGTGGG + Intergenic
1194473569 X:94330224-94330246 AAGACAGAAGTGATTTTGCTGGG + Intergenic
1194473615 X:94331104-94331126 AAGACAGAAGTGATTTTGCTGGG - Intergenic
1195174579 X:102303240-102303262 TAGACTGAAGTCATGATAATTGG - Intergenic
1195184286 X:102383853-102383875 TAGACTGAAGTCATGATAATTGG + Intronic
1196167806 X:112554764-112554786 TTGACAGAAATGAACATAATTGG - Intergenic
1196290822 X:113938917-113938939 TATACACTAGTGATTATTATGGG - Intergenic
1197942895 X:131808052-131808074 AAGACAGAAGTCATTATATTGGG - Intergenic
1198165864 X:134056401-134056423 TATACAGAAATGTTCATAATAGG - Intergenic
1198376243 X:136042706-136042728 TACACAAATGGGATTATAATAGG + Intronic
1199169914 X:144722996-144723018 TACACAAAAGTCATTATAAAAGG - Intergenic
1199313056 X:146344138-146344160 TAGACATTAGTGATTTTAAATGG - Intergenic
1200308255 X:155050986-155051008 TAGAGAGAAGTGATATTGATAGG + Intronic
1200462693 Y:3477396-3477418 TAAATAGAAGTGATTAGAGTGGG + Intergenic
1201946037 Y:19511252-19511274 TGGACAAAAGTTATTTTAATGGG - Intergenic