ID: 1022829831

View in Genome Browser
Species Human (GRCh38)
Location 7:34054835-34054857
Sequence AGAAGGAAACTGGTGGTTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022829821_1022829831 25 Left 1022829821 7:34054787-34054809 CCCAAGAGAGCACTATTAGTGCA 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1022829831 7:34054835-34054857 AGAAGGAAACTGGTGGTTCGTGG No data
1022829822_1022829831 24 Left 1022829822 7:34054788-34054810 CCAAGAGAGCACTATTAGTGCAG 0: 1
1: 0
2: 1
3: 1
4: 79
Right 1022829831 7:34054835-34054857 AGAAGGAAACTGGTGGTTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022829831 Original CRISPR AGAAGGAAACTGGTGGTTCG TGG Intronic
No off target data available for this crispr