ID: 1022830323 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:34059387-34059409 |
Sequence | CTGGGGGAGGGGATGGTGGG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 3912 | |||
Summary | {0: 1, 1: 2, 2: 23, 3: 336, 4: 3550} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1022830310_1022830323 | 16 | Left | 1022830310 | 7:34059348-34059370 | CCACTTGTAGCTGGATTGATAGT | 0: 1 1: 0 2: 0 3: 4 4: 86 |
||
Right | 1022830323 | 7:34059387-34059409 | CTGGGGGAGGGGATGGTGGGGGG | 0: 1 1: 2 2: 23 3: 336 4: 3550 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1022830323 | Original CRISPR | CTGGGGGAGGGGATGGTGGG GGG | Intronic | ||
Too many off-targets to display for this crispr |