ID: 1022830323

View in Genome Browser
Species Human (GRCh38)
Location 7:34059387-34059409
Sequence CTGGGGGAGGGGATGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3912
Summary {0: 1, 1: 2, 2: 23, 3: 336, 4: 3550}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022830310_1022830323 16 Left 1022830310 7:34059348-34059370 CCACTTGTAGCTGGATTGATAGT 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1022830323 7:34059387-34059409 CTGGGGGAGGGGATGGTGGGGGG 0: 1
1: 2
2: 23
3: 336
4: 3550

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022830323 Original CRISPR CTGGGGGAGGGGATGGTGGG GGG Intronic
Too many off-targets to display for this crispr