ID: 1022831496

View in Genome Browser
Species Human (GRCh38)
Location 7:34072020-34072042
Sequence GAAGCCACAGTGTCTTGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022831485_1022831496 27 Left 1022831485 7:34071970-34071992 CCCAGCTAGTTAACAAGTTTGCA 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1022831496 7:34072020-34072042 GAAGCCACAGTGTCTTGGGTTGG 0: 1
1: 0
2: 2
3: 18
4: 204
1022831484_1022831496 28 Left 1022831484 7:34071969-34071991 CCCCAGCTAGTTAACAAGTTTGC 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1022831496 7:34072020-34072042 GAAGCCACAGTGTCTTGGGTTGG 0: 1
1: 0
2: 2
3: 18
4: 204
1022831486_1022831496 26 Left 1022831486 7:34071971-34071993 CCAGCTAGTTAACAAGTTTGCAG 0: 1
1: 0
2: 1
3: 5
4: 75
Right 1022831496 7:34072020-34072042 GAAGCCACAGTGTCTTGGGTTGG 0: 1
1: 0
2: 2
3: 18
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022831496 Original CRISPR GAAGCCACAGTGTCTTGGGT TGG Intronic
902242736 1:15099693-15099715 GAAGCCACAGAGTGTTGAGCAGG + Intronic
902906072 1:19558260-19558282 AAAGCCAGTGTGTCTTGGTTAGG + Intergenic
904353776 1:29925412-29925434 GAAGCCACTGTATTTTGGGATGG + Intergenic
904371450 1:30050039-30050061 CAAGCCTGAGTGTCTGGGGTTGG - Intergenic
904385436 1:30138919-30138941 GTTGCCACAGTGGCTGGGGTAGG + Intergenic
904616169 1:31751070-31751092 GAGGCCCCAGTGTCCTGGGATGG + Intronic
907893185 1:58656150-58656172 GAAGCCACAGTCTCCTCTGTTGG + Exonic
908510256 1:64845455-64845477 GAAACCAGAGTGTCCTGGGAGGG - Intronic
911623158 1:100090613-100090635 GAGGCCACAGTGCCTTTGGTAGG - Intronic
912798342 1:112706150-112706172 GTAGCCACACTGTCTTGTCTTGG - Exonic
912952228 1:114127958-114127980 GAAGCCACCGGGTCCTTGGTAGG - Intronic
914629222 1:149492903-149492925 GGAGCAACAGTGTGTTGGCTTGG + Intergenic
914629755 1:149497660-149497682 GGAGCAACAGTGTGTTGGCTTGG + Intergenic
914630290 1:149502421-149502443 GGAGCAACAGTGTGTTGGCTTGG + Intergenic
914630824 1:149507182-149507204 GGAGCAACAGTGTGTTGGCTTGG + Intergenic
914631355 1:149511943-149511965 GGAGCAACAGTGTGTTGGCTTGG + Intergenic
914631887 1:149516699-149516721 GGAGCAACAGTGTGTTGGCTTGG + Intergenic
914632423 1:149521454-149521476 GGAGCAACAGTGTGTTGGCTTGG + Intergenic
914632958 1:149526205-149526227 GGAGCAACAGTGTGTTGGCTTGG + Intergenic
914633493 1:149530934-149530956 GGAGCAACAGTGTGTTGGCTTGG + Intergenic
914634029 1:149535689-149535711 GGAGCAACAGTGTGTTGGCTTGG + Intergenic
914634562 1:149540436-149540458 GGAGCAACAGTGTGTTGGCTTGG + Intergenic
914635097 1:149545173-149545195 GGAGCAACAGTGTGTTGGCTTGG + Intergenic
914635632 1:149549910-149549932 GGAGCAACAGTGTGTTGGCTTGG + Intergenic
915293176 1:154900013-154900035 GAAGCCAGATTGGCTAGGGTGGG - Intergenic
915568350 1:156729218-156729240 GAGGCCACAGGGGCGTGGGTGGG + Intronic
918315743 1:183321339-183321361 GAAGCCTCAGAGGCTAGGGTAGG + Intronic
919850628 1:201669712-201669734 GACACCACAGTGGCCTGGGTAGG + Intronic
922941913 1:229474285-229474307 TAAGCCACTGTGTTTTGGGGTGG + Intronic
923751133 1:236747017-236747039 GCAGCCACAGTGACTGGGGAGGG - Intronic
924644908 1:245868785-245868807 GCAGCCACAGTGGGATGGGTAGG - Intronic
1062849017 10:728979-729001 GAAGGCATGGTGTCTTGGGGAGG - Intergenic
1062887311 10:1027310-1027332 GCAGCCACATTGCCTTGGGCAGG - Intergenic
1063292200 10:4761119-4761141 GAAGTCACTGTGTTTTGGGGAGG - Intergenic
1063371522 10:5525621-5525643 GAAGCCACAGTGCCCAGGGGAGG - Exonic
1064073076 10:12247111-12247133 GAGGACACAGTGTCTGGAGTGGG - Intronic
1065003928 10:21362430-21362452 GCAGCCTCAGTCTCCTGGGTTGG + Intergenic
1065977282 10:30853527-30853549 GAGGGAAGAGTGTCTTGGGTGGG - Intronic
1066303793 10:34119518-34119540 GAGGCCCCAGTGACTTGGGAAGG + Intronic
1067803127 10:49373652-49373674 GAAGACTCAGTGTCTTGTGAGGG - Intronic
1072247930 10:93559559-93559581 GAAGCCCCAGTGCCTTGAGGAGG - Intergenic
1072617104 10:97057179-97057201 GAATCCTGGGTGTCTTGGGTGGG - Intronic
1072781378 10:98253990-98254012 GCAGCTACAGTGTCATGGTTAGG + Intronic
1075907823 10:126097578-126097600 GAACTCACAGTTTCTTGGGAGGG + Intronic
1077741418 11:4849587-4849609 GAAGTCAGACTGTCTGGGGTTGG - Intronic
1078778505 11:14415310-14415332 GAAGCCACAGGCTCCTGGGTGGG + Intergenic
1081363126 11:42204380-42204402 GGATACACAGTGTCTGGGGTGGG + Intergenic
1084451004 11:69238242-69238264 GAAGCCACAATGTCTTTTATCGG + Intergenic
1084869269 11:72085677-72085699 TAAGCCACTGTGTTTTGGGATGG - Intronic
1085649496 11:78254717-78254739 GCAGCCTCAATCTCTTGGGTTGG - Intronic
1087151126 11:94860815-94860837 AAAGCCACATTGCCTTGGGATGG + Intronic
1087681824 11:101226766-101226788 GAAGAGACAGTGTCGTCGGTTGG + Intergenic
1088866482 11:113852551-113852573 GTAGCAACAGTGTCTTGACTGGG + Exonic
1089155604 11:116399953-116399975 GAACCCAAAGTGACTGGGGTGGG + Intergenic
1089563244 11:119356529-119356551 GAAACAACTGTGTCTTGGGGGGG - Exonic
1091082664 11:132686276-132686298 GAAACCACAGTGCCTTGCCTCGG + Intronic
1092702120 12:11243618-11243640 GAAGCCACAGTGGCATGTGAGGG + Intergenic
1099618562 12:84972423-84972445 GAAGCCACGGTATTTTGGGGTGG - Intergenic
1101023681 12:100579163-100579185 GAAGCCCCATTGTCTTGGCATGG - Intronic
1101343697 12:103865361-103865383 TAAGCCACAGAGTTTTGGGATGG + Intergenic
1102785138 12:115598814-115598836 GAGGCTTCAGTGTCTGGGGTAGG - Intergenic
1103003606 12:117404809-117404831 AAAGGGATAGTGTCTTGGGTTGG + Intronic
1103183507 12:118935953-118935975 GAAGTATCAGTGTCTTGGGATGG - Intergenic
1107064050 13:36193412-36193434 GTAGGCACAGGGTTTTGGGTGGG - Intronic
1107425333 13:40287482-40287504 TAAGTCACAGTTTCTTGGCTTGG + Intergenic
1108683243 13:52797442-52797464 GAAGCCAGCATGTCTTGGGAAGG + Intergenic
1110523149 13:76504752-76504774 AAAGGCACATTGTCTTAGGTGGG - Intergenic
1112331446 13:98479811-98479833 GAGGCCACACTTTCTTGGGAAGG - Intronic
1112564104 13:100537593-100537615 GAAGCCACAGTGTCATTGAGGGG + Intronic
1113403592 13:110018212-110018234 GGAGCCTGTGTGTCTTGGGTCGG + Intergenic
1114678504 14:24462049-24462071 GAAGCCAGTGTGACTTGGGCAGG - Intergenic
1115873823 14:37838043-37838065 GAAGCCAGATTGTGTTTGGTTGG + Intronic
1117295670 14:54377008-54377030 TAAGCCACTGTGTTTTGGGGTGG - Intergenic
1118724794 14:68621454-68621476 ATATCCACAGTGGCTTGGGTAGG - Intronic
1119643761 14:76334188-76334210 GAAGCCAGAGGGGCCTGGGTGGG + Intronic
1120404732 14:84080409-84080431 GATGCCACAATGTGTTGGTTTGG - Intergenic
1120466691 14:84866840-84866862 GAAGCCAGAGTCTTGTGGGTAGG + Intergenic
1120677387 14:87436776-87436798 GAAGCCACAGTAGCATGGGCAGG + Intergenic
1123035706 14:105471080-105471102 GAAGCCACAGGGTCTTCGGCAGG - Intergenic
1123770331 15:23522278-23522300 GAAGCCACAGTTTCCAGGGCTGG - Intergenic
1125438086 15:39669420-39669442 GAAAGCACAGTGTCATGGTTTGG - Intronic
1126008779 15:44283181-44283203 AAAGCCATGGTGTCATGGGTTGG - Intergenic
1126299038 15:47174616-47174638 GATGCCACTGTGGCTTGGGCAGG + Intergenic
1126464383 15:48948061-48948083 GAATACACAGGGTCTTGGATAGG + Intronic
1128151340 15:65365319-65365341 GAGGCCACAGGGTCCTGGGGTGG - Intronic
1128610971 15:69073152-69073174 GAATTCACAGCTTCTTGGGTGGG - Intergenic
1128800058 15:70491652-70491674 GCAGCTATAGGGTCTTGGGTAGG + Intergenic
1129296789 15:74604240-74604262 GAAGCCACAGTGGGCTGGGTGGG + Intronic
1131228179 15:90642283-90642305 GAAGCCACAGTGTCTGAGATGGG - Exonic
1132500019 16:280998-281020 GGAGCCCCTCTGTCTTGGGTGGG + Intronic
1132653533 16:1032044-1032066 GAAACCACACTGGATTGGGTGGG - Intergenic
1136400243 16:30013057-30013079 AAAGCCAAAGTGTCTGGGCTGGG + Intronic
1138291043 16:55847014-55847036 GAAGCCACAGTTCCTTGGACAGG - Intronic
1139404770 16:66709565-66709587 GAAGAGACAGGGTCTTGGCTGGG + Intergenic
1142328497 16:89434207-89434229 GAATCCATAGTGTCTTGAGGAGG - Intronic
1143416279 17:6753199-6753221 GTAGCCACAGTGTCCTGGAAAGG + Intergenic
1146929682 17:36768418-36768440 GAAGCCACGGTGTGGTGGGCAGG + Intergenic
1147452858 17:40516859-40516881 GAAGCCACAGTTTCCTGTCTGGG - Intergenic
1150876145 17:68972646-68972668 AAAGGCATTGTGTCTTGGGTTGG + Intergenic
1152106985 17:78336108-78336130 TAAGACACAGGGTCTTAGGTCGG + Intergenic
1152662044 17:81547049-81547071 GTGGCCACAGGGTCTCGGGTGGG + Exonic
1154067964 18:11126977-11126999 GTACCCACAGTGTCTTGGGTAGG - Intronic
1154262036 18:12843554-12843576 AAAGCCACAGCACCTTGGGTGGG - Intronic
1154492278 18:14931581-14931603 GAGGCTACAGTGTGTTGTGTGGG + Intergenic
1155246781 18:23918508-23918530 GAAGCTTCAGTGTCTTGAGAAGG - Intronic
1160770142 19:827503-827525 GGAGCCCCAGTGGCTTGGGATGG + Intronic
1161245644 19:3250093-3250115 GAAGCCACCATGTTTTGGGAGGG - Intronic
1162762722 19:12897892-12897914 GAGGCCTCAGTGTCTGGGGAGGG + Intronic
1164761014 19:30728274-30728296 GATGCCTCAGTGTTATGGGTGGG - Intergenic
1166313725 19:41977101-41977123 GAATCCACTGTGTCTTGGCTGGG - Intronic
925218399 2:2117021-2117043 GAGGCCACTGGGTTTTGGGTGGG + Intronic
926783225 2:16494869-16494891 GAAGCCATATTGTCTTTAGTGGG - Intergenic
927251339 2:20997261-20997283 GAAGCCCCAGGGACTTGGGCTGG + Intergenic
927827222 2:26317218-26317240 GAAGGCACAGTGCCTAGGGGAGG - Intronic
928042886 2:27896245-27896267 GAAGCCACCGTGGCTTGAGCAGG + Intronic
928045844 2:27930808-27930830 GAAATCACAGTGGCTTTGGTTGG + Intronic
931502741 2:62888097-62888119 GGAGGCACATTGTCTTAGGTTGG + Intronic
932890999 2:75597507-75597529 GAAGCCACTGAGTTTTGGGATGG - Intergenic
935696598 2:105776193-105776215 GTTGCTACAGTGTCCTGGGTGGG + Intronic
937984053 2:127630679-127630701 GCAGCCTCAGTGACTTGGGAGGG - Intronic
940109105 2:150131077-150131099 GAAGCTAGAGTTACTTGGGTAGG + Intergenic
941270573 2:163422251-163422273 GAAACTACAGTGTTTGGGGTTGG + Intergenic
944160718 2:196656295-196656317 GATGGCACAGTGCCTGGGGTGGG + Intronic
945204119 2:207313453-207313475 GAAGCCAAAGGGTTTTGGGTGGG - Intergenic
945970782 2:216228949-216228971 GAATCTACATTGTTTTGGGTAGG + Intergenic
946757219 2:222959785-222959807 GAAGCCAAATTGTGTTGGGCTGG - Intergenic
948141852 2:235679113-235679135 GAAAGCACAGTGTCTTGATTTGG + Intronic
948150979 2:235744447-235744469 GAAGACAGAGTGGCTTGGGTGGG + Intronic
948742249 2:240055687-240055709 GGAGCCACCGTGTCCTGGCTTGG - Intergenic
1170119672 20:12898315-12898337 TAAGCCACAGAGTTTTGGGGTGG - Intergenic
1172095033 20:32456423-32456445 GTGGCCACAGTGCCTTGGGTGGG - Intronic
1174051096 20:47768171-47768193 GACGCCACTTTGTCTTGAGTGGG + Intronic
1175075348 20:56367662-56367684 GAAGCCTCAGTGTCTCAGTTTGG - Exonic
1177738228 21:25119697-25119719 GAAGCCTCAGTGTCTTCAGAGGG - Intergenic
1177885096 21:26737303-26737325 GCAGCCACTGTGTCTTGCTTAGG + Intergenic
1179643665 21:42762526-42762548 TAAGCCTCAGTTTCTTGGGCTGG - Intronic
1179798250 21:43798239-43798261 GAAGCCAGAGTGACTTCTGTGGG + Intronic
1180847651 22:18992893-18992915 GAATCCACAGTCTCATGTGTGGG - Intergenic
1183044886 22:35211645-35211667 GAAGGCACGGTGCTTTGGGTTGG - Intergenic
1183283888 22:36950806-36950828 GAAGCCTCCGGGTCTTGGATCGG + Intergenic
1185248814 22:49788728-49788750 GAAGCCTCAGTGGCTGGGCTTGG - Intronic
949149407 3:746982-747004 GAAGTCTGACTGTCTTGGGTAGG + Intergenic
950664521 3:14487168-14487190 AAGGCCACAGTATTTTGGGTTGG + Exonic
950667340 3:14505562-14505584 GGAGTCACAGTGTCTTGGCTGGG - Intronic
951071436 3:18333365-18333387 GATGCCACTGAGTTTTGGGTTGG - Intronic
954591918 3:51790148-51790170 GGTGCCACATTGTCTTGGGCTGG + Intergenic
954719650 3:52550505-52550527 GAAGCCGCTGGGTCTTTGGTGGG + Exonic
954808373 3:53233098-53233120 GTAGCCACAGTGTCTGGGCGAGG + Intronic
957981575 3:87518442-87518464 GAAGCCACAGTGATATGGTTTGG + Intergenic
969184854 4:5467499-5467521 GAAGTCACAGTGAATTAGGTAGG - Intronic
969324288 4:6431919-6431941 GAAGCTTCAGTGTCTGGGGAGGG + Intronic
969851435 4:9960222-9960244 GGAGCCTGAGTGACTTGGGTAGG - Intronic
972658592 4:41091496-41091518 AAGGCCACAGTGTCTTGTTTGGG - Intronic
973990070 4:56396427-56396449 GACACCACAGAGTCTTGTGTTGG - Intronic
975230530 4:71927517-71927539 AAATCCATAGTGTCTTGGCTGGG + Intergenic
977839681 4:101687446-101687468 GAAGCCACAGCAACTTGGCTGGG - Intronic
978620846 4:110633259-110633281 AAAGCCACAGTGTGCTGGGGAGG + Intronic
980692966 4:136320003-136320025 TAAGCTGCACTGTCTTGGGTTGG - Intergenic
982138342 4:152294168-152294190 GAAGCCAGACTGACTTGGGTGGG - Intergenic
982511066 4:156284066-156284088 GAAGCCACAGTGCCTAGGTTGGG - Intergenic
983541889 4:168919998-168920020 GAAGCCACAGTATGTTTAGTAGG - Intronic
988409943 5:30874291-30874313 GAAGACACAGAGTCCTGGGTTGG - Intergenic
988483162 5:31646272-31646294 GTAGCCATAATATCTTGGGTTGG + Intronic
988619349 5:32806754-32806776 GAAGATACAGGATCTTGGGTGGG - Intergenic
992758319 5:79929979-79930001 GAAGCCAATGTGTCTTGAGGGGG + Intergenic
993093321 5:83452955-83452977 GTAGCCACAGTGTCAGGGGCTGG - Intergenic
993652043 5:90533824-90533846 GGAGCTGCAGTGTTTTGGGTTGG + Intronic
994584165 5:101684268-101684290 AAAGCCACAGAGTTTTGGGGTGG + Intergenic
997414369 5:133713681-133713703 CAAGCCACTGGGTCCTGGGTGGG + Intergenic
998177926 5:139913284-139913306 GAAGCCTCAGTGACTGGGGCAGG - Intronic
1001839761 5:174865049-174865071 GAATTCACACTGTCTGGGGTTGG + Intergenic
1002273366 5:178087347-178087369 CAAGCCCCAGTCTCTTGGATAGG - Intergenic
1002450409 5:179315315-179315337 GAGGCCACAGTGCTTTGGGAAGG + Intronic
1002577338 5:180181864-180181886 GAGACCACAGTTTCTTCGGTTGG + Intronic
1004635558 6:17464550-17464572 GAAGTCACAGTCCCTTGGGTTGG - Intronic
1005190087 6:23211168-23211190 GAAGCCAAAGTGCCATGGGAAGG - Intergenic
1005294121 6:24407675-24407697 GAGGCCAAAGTCTCTTTGGTGGG - Intronic
1008534885 6:52500120-52500142 GAGGCCACAGTTGCTGGGGTAGG + Exonic
1011912364 6:92456944-92456966 GATGCCACAGTGTATTGGGCAGG + Intergenic
1017453307 6:154574907-154574929 GAAGGGACAGTCTCTTGGATTGG + Intergenic
1017729855 6:157305727-157305749 GAAGCCACAGTGTTTCAGGATGG + Intronic
1017917807 6:158846168-158846190 GAAGCCAAAGTTTCTGGTGTGGG + Intergenic
1018981172 6:168602846-168602868 GTAGCCACAGTGGCTGGGGAGGG + Intronic
1019893540 7:3965773-3965795 GCAGCCACACTGTCTGGGGGAGG - Intronic
1022421548 7:30228194-30228216 GAGGCCACAGTGTTTAGTGTTGG + Intergenic
1022831496 7:34072020-34072042 GAAGCCACAGTGTCTTGGGTTGG + Intronic
1027252867 7:76409944-76409966 GGAGCCACAGTGTATGGAGTGGG + Intronic
1028876170 7:95825683-95825705 TAAGCCAGAATGTCTGGGGTGGG - Intronic
1029304625 7:99609853-99609875 GAAGCCCCACTGACTTGGGAGGG - Intergenic
1030866525 7:114706798-114706820 TTAGCCACAGTGTCTTGCATTGG + Intergenic
1031762382 7:125730067-125730089 GAAGCCAGTGTGTGTTGGGTTGG + Intergenic
1034896893 7:154881919-154881941 GAAGCCACTGGGTCATTGGTAGG + Intronic
1037232735 8:16678737-16678759 GTAGCCACATTGCCTTGGATTGG - Intergenic
1037717138 8:21410113-21410135 GCAGCCCCAGTGCCTTGGGGAGG + Intergenic
1039400368 8:37263907-37263929 AAAGCCACCCTGACTTGGGTGGG - Intergenic
1039484535 8:37900321-37900343 GAAAGCACAGTGAATTGGGTGGG - Intergenic
1041185571 8:55297113-55297135 GAGCTCACAGTGTCTTGGGCTGG + Intronic
1048679932 8:136829969-136829991 GAAGCATCAGTGTCCTGAGTGGG - Intergenic
1049850587 8:144828031-144828053 GAAGGAACGGTGCCTTGGGTGGG + Intronic
1050703339 9:8365962-8365984 TAAGCCACAGTGTTTTGGGTTGG + Intronic
1051879720 9:21827362-21827384 GAAGCCACAGTGGCCTGGACTGG - Intronic
1052989242 9:34509148-34509170 GCACCCACACTGTCCTGGGTGGG + Intronic
1055438680 9:76317946-76317968 TAAGCCACTGAGTTTTGGGTTGG + Intronic
1057179989 9:93024622-93024644 GCACCTTCAGTGTCTTGGGTAGG + Intronic
1058338968 9:103870377-103870399 AAAGAGACAGTGTCTTGGGTTGG - Intergenic
1059531939 9:115043350-115043372 GCAGCCACAGAGTCTGGGGGTGG - Intronic
1060558452 9:124522658-124522680 CCAACCACAGCGTCTTGGGTGGG - Exonic
1061886176 9:133592087-133592109 GAGGTCACAGTGTCCTGGGGAGG - Intergenic
1186733589 X:12437222-12437244 GAAGCTAAAGTGTCTTGTTTGGG - Intronic
1187016166 X:15331489-15331511 GAAGCCCCATTGTCTTGGCGTGG + Exonic
1190177750 X:48165501-48165523 GAACCCACAGCATCCTGGGTAGG - Intergenic
1190180426 X:48187106-48187128 GAACCCACAGCATCCTGGGTAGG + Intronic
1190196858 X:48327206-48327228 GAACCCACAGCATCCTGGGTAGG - Intergenic
1190204554 X:48392484-48392506 GAACCCACAGCATCCTGGGTAGG - Intronic
1190205982 X:48402919-48402941 GAACCCACAGCATCCTGGGTAGG + Intronic
1190658391 X:52633087-52633109 GAAGCCACAGCATCCTGGGTAGG - Intergenic
1190659941 X:52644919-52644941 GAACCCACAGCATCCTGGGTAGG + Intronic
1190663595 X:52677568-52677590 GAACCCACAGCATCCTGGGTAGG - Intronic
1190675828 X:52780854-52780876 GAACCCACAGCATCCTGGGTAGG + Intronic
1192630861 X:72777085-72777107 GGAGCCCCAGGGTCTTGAGTCGG - Intronic
1192650848 X:72943716-72943738 GGAGCCCCAGGGTCTTGAGTCGG + Intronic
1195720404 X:107861860-107861882 AAGGCTACAGTGTCCTGGGTTGG - Intronic
1196391610 X:115212673-115212695 TAAGAGACAGGGTCTTGGGTGGG + Intronic
1196817184 X:119674675-119674697 GGAGACACAGAGTCTTGGGGAGG - Intronic
1200153638 X:153963870-153963892 GAAGCCACTTTGCCTTGGGCTGG - Intronic