ID: 1022833344

View in Genome Browser
Species Human (GRCh38)
Location 7:34090396-34090418
Sequence AGGGAGAAGCAATATGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 339}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022833344_1022833353 18 Left 1022833344 7:34090396-34090418 CCAGCCTCATATTGCTTCTCCCT 0: 1
1: 0
2: 0
3: 34
4: 339
Right 1022833353 7:34090437-34090459 CCGAGCAATCCAAGAGGAATAGG No data
1022833344_1022833350 12 Left 1022833344 7:34090396-34090418 CCAGCCTCATATTGCTTCTCCCT 0: 1
1: 0
2: 0
3: 34
4: 339
Right 1022833350 7:34090431-34090453 TGCCAACCGAGCAATCCAAGAGG 0: 1
1: 0
2: 0
3: 0
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022833344 Original CRISPR AGGGAGAAGCAATATGAGGC TGG (reversed) Intronic
905660633 1:39720886-39720908 AGGGAAAATTAATATCAGGCTGG - Intronic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
906218027 1:44055609-44055631 CCTGAGAAGCAATATGTGGCGGG - Intergenic
906483122 1:46214047-46214069 AGGAAAAAGCAACTTGAGGCCGG + Intronic
906637258 1:47417496-47417518 AGGGAGAAGAAATGAGAGGCTGG - Exonic
906656558 1:47552474-47552496 AGAGAGAAGCAGTATGGGTCAGG + Intergenic
907112773 1:51941404-51941426 AAGGAGAAGAGATAGGAGGCAGG + Intronic
907281034 1:53347129-53347151 AGGGAGAAGCAAACTGGGGGAGG + Intergenic
907969007 1:59362329-59362351 GGAGAGAAGAAATAGGAGGCAGG - Intronic
909021868 1:70440677-70440699 AGGCAGTAGCATTTTGAGGCAGG + Intergenic
909608309 1:77528727-77528749 AGGCAGAAGGAATATGAGGGAGG + Intronic
910447252 1:87311117-87311139 AGGTTGAAGCAATGGGAGGCTGG + Intergenic
910668979 1:89753914-89753936 AGGGAGAAGAGCTAAGAGGCTGG + Intronic
913234221 1:116766180-116766202 AGGGAGAAGGACAATGAGCCTGG + Intronic
915019893 1:152769215-152769237 AGGGAGAGGAAATATGAGACAGG + Intronic
915687108 1:157644703-157644725 AGTGAGACACAATATGAAGCAGG + Intergenic
916678007 1:167080465-167080487 AGAGAGAAGCACTAGGAGGCAGG - Intronic
919321629 1:196048051-196048073 AGAGAGGAGAAAAATGAGGCAGG + Intergenic
920308282 1:205032756-205032778 AGGCAGAAGGAACGTGAGGCTGG - Intergenic
920730206 1:208476376-208476398 AGGGAAAAAGAATATGAGCCAGG + Intergenic
923447264 1:234083770-234083792 TGGGAAAAGCATTGTGAGGCAGG + Intronic
923843682 1:237704114-237704136 AGGTAGAAGCTATATGAGGTAGG + Intronic
924313426 1:242771166-242771188 AGGGAGAAGGAATATTAGATAGG - Intergenic
1063350959 10:5354657-5354679 AGGGAGAAGAAATATGGAGAAGG - Intergenic
1063697925 10:8355884-8355906 AGAGAGAAGCATCCTGAGGCAGG - Intergenic
1065030302 10:21579418-21579440 AGAGAGAAAGAATATGAGGCAGG - Intronic
1065475646 10:26135450-26135472 AAGGAGAATCAACATAAGGCAGG + Intronic
1067081426 10:43214660-43214682 AGGGAAGAGCAGTATAAGGCAGG + Intronic
1067394616 10:45903045-45903067 GGGGAGAAGAAAGATGGGGCAGG + Intergenic
1067446661 10:46353834-46353856 TCAAAGAAGCAATATGAGGCTGG + Intergenic
1067545521 10:47189927-47189949 AGGGAGGAGCAACAACAGGCAGG + Intergenic
1067590723 10:47506933-47506955 TCAAAGAAGCAATATGAGGCTGG - Intronic
1067637841 10:48015032-48015054 TCAAAGAAGCAATATGAGGCTGG - Intergenic
1067862939 10:49872176-49872198 GGGGAGAAGAAAGATGGGGCAGG + Intronic
1069595915 10:69670122-69670144 AGGGAGAAGGTTGATGAGGCAGG - Intergenic
1070134438 10:73679456-73679478 TCAAAGAAGCAATATGAGGCTGG - Intronic
1070653629 10:78255702-78255724 ATGGAAAAGCAGTAAGAGGCTGG - Intergenic
1071986819 10:91060300-91060322 AAGGAGAAGCAATGTAGGGCAGG - Intergenic
1072940640 10:99760555-99760577 AGGGAGCAGCATCCTGAGGCAGG + Intergenic
1074081264 10:110169836-110169858 AGGGAGAAGGGAGATGAGGAGGG - Intergenic
1075213429 10:120511178-120511200 AGGAAGAGGCAAGTTGAGGCAGG + Intronic
1075473306 10:122710450-122710472 ATTGAGATGGAATATGAGGCTGG + Intergenic
1076714155 10:132354795-132354817 TGGGAGAAACAAGAGGAGGCCGG + Intronic
1076813849 10:132904489-132904511 AAGGAGAAGTCATATGAGACTGG - Intronic
1077520010 11:3027374-3027396 GGAGGGAAGCAATCTGAGGCTGG + Intronic
1078320901 11:10333627-10333649 AGGGAAAGGCCATATGAGGACGG + Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078453042 11:11454449-11454471 AGGGAGAAGGAAGATAAGGAGGG + Intronic
1078540784 11:12211446-12211468 AGTGAGAATCAGCATGAGGCTGG + Intronic
1078760261 11:14245826-14245848 AAGGAGAAGCAACACGAGGCAGG + Intronic
1080833129 11:35915106-35915128 AGTGAGAAGCAATTTGGGTCAGG - Intergenic
1081382051 11:42428757-42428779 TGGGAGAAGGAATTTTAGGCAGG + Intergenic
1084463324 11:69308263-69308285 CGGGAGAGGCAAGATGAGGTTGG - Intronic
1084929405 11:72542450-72542472 AGGCTGAGGCAATGTGAGGCAGG + Intergenic
1086158685 11:83696231-83696253 AGGGAGAACTAATATTAGGAAGG + Intronic
1087161098 11:94948863-94948885 AGTGAGAGGCAAGATGAGGCAGG - Intergenic
1087276943 11:96170235-96170257 AGGGAGAAATAATAAAAGGCTGG - Intronic
1089565622 11:119369803-119369825 AGGGAGAGGTCATCTGAGGCTGG - Intronic
1089925009 11:122248197-122248219 ATAGAGAAGAAATAAGAGGCAGG + Intergenic
1090198680 11:124839092-124839114 AGGGAGAAGGAATAGGGGGCAGG - Intergenic
1095090767 12:38102174-38102196 AGGGGAATGCTATATGAGGCTGG - Intergenic
1096795065 12:54071601-54071623 AGGCAGAAACAAGATGGGGCAGG + Intergenic
1097007263 12:55928223-55928245 AGGAAAAAGCTATATGAGGGTGG - Intronic
1097323502 12:58250452-58250474 AGGGAGGAGAAATATGGGGAGGG + Intergenic
1097699666 12:62807136-62807158 AGTGAGGAGCAAGATGAGGGTGG + Intronic
1099998043 12:89800735-89800757 AGAGAAAAGCAATATGTGCCTGG - Intergenic
1102397979 12:112603787-112603809 AGGGCGAAGAAAAATGAGACTGG - Intronic
1102464196 12:113119057-113119079 AGGGGGAAGAAAGATGAGACGGG - Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1103658477 12:122494184-122494206 CAGGAAAAGAAATATGAGGCAGG - Intronic
1104275045 12:127319263-127319285 AGGAAGATGTATTATGAGGCTGG + Intergenic
1104647569 12:130508279-130508301 AGGGAGAGGCAAGATCTGGCAGG - Intronic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1105038535 12:132943836-132943858 AGGGCGAGGGAAAATGAGGCTGG + Intronic
1105814293 13:24020106-24020128 AGGGAGAAGCTGTATGCAGCTGG - Intronic
1106279877 13:28257251-28257273 AGGGAGAAGGAACAGGAGTCAGG + Intronic
1106548107 13:30747848-30747870 AGGGAGAAGCGACATGAGGGTGG - Intronic
1106825969 13:33520771-33520793 AGGAAGAAGTTACATGAGGCAGG + Intergenic
1107508355 13:41058309-41058331 AGGGGGAACAAGTATGAGGCTGG - Intronic
1110407598 13:75168226-75168248 AGAGAAAAGCAGAATGAGGCAGG + Intergenic
1112654573 13:101436655-101436677 AGGAAGAAGCAAGATTGGGCAGG + Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113558210 13:111255386-111255408 ATGGGCAAGCAACATGAGGCAGG - Intronic
1114527924 14:23377969-23377991 TGGGGAAAGCATTATGAGGCAGG + Intronic
1114556979 14:23567729-23567751 AGGCAGAAGCCAGGTGAGGCTGG - Exonic
1115022354 14:28697863-28697885 AAGGAGAACAGATATGAGGCGGG - Intergenic
1116658501 14:47678423-47678445 AGGGAAAAGCTATAGAAGGCAGG + Intergenic
1117479215 14:56126389-56126411 AGTGAGAAGCATTATGCGGATGG - Intronic
1117978701 14:61321695-61321717 GAGGAGAAGCAAGAGGAGGCGGG + Exonic
1120565533 14:86050999-86051021 AGGGAGAGGGAAGAGGAGGCGGG - Intergenic
1120590793 14:86371221-86371243 AGGGAGAGGAAAGATGATGCAGG - Intergenic
1121987462 14:98521568-98521590 AGAGAATAGCAAGATGAGGCTGG + Intergenic
1122218738 14:100221852-100221874 AGGGAGAAGGAATATTGGGGAGG + Intergenic
1124807845 15:32904474-32904496 TGGGAGAGGAAATTTGAGGCTGG + Intronic
1125792703 15:42381254-42381276 AGGGAGAAGAAAAATGATACAGG - Intronic
1126078067 15:44932312-44932334 AGGCAGAAGCAATATAAAGTTGG + Intergenic
1126930046 15:53637754-53637776 AGGGAGAGAGAATATGGGGCTGG - Intronic
1128771510 15:70286159-70286181 TGGGAGAAGTGATATGAGGCTGG - Intergenic
1129228102 15:74181465-74181487 TGGGAGAAGAAAGCTGAGGCAGG + Intronic
1129294066 15:74590020-74590042 TGGGAGAAGGAAGCTGAGGCTGG + Intronic
1132758958 16:1499754-1499776 AGGGTGAAGCAAGATGTGGCCGG - Intronic
1134649599 16:15898200-15898222 AGGGAGAAGAAAGAGGAGGAGGG - Intergenic
1134848086 16:17458143-17458165 GGGGAGAAGCAATAAAAGCCGGG - Intronic
1135791502 16:25400805-25400827 AGATAGAAGAAACATGAGGCAGG - Intergenic
1136472119 16:30488032-30488054 AAGGAGAAGCTATATAAGCCAGG + Intronic
1136863995 16:33726631-33726653 AGGAAGACGGATTATGAGGCAGG - Intergenic
1137029139 16:35506239-35506261 AGGGAGGAGCAAGAAGGGGCGGG + Intergenic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1139296070 16:65902002-65902024 AGGGAGAAGCCCCATGAGGCAGG + Intergenic
1139306834 16:65993759-65993781 AGGGAGAGGCAGCATGAGCCTGG - Intergenic
1139576961 16:67847624-67847646 AGGGTCAGGGAATATGAGGCGGG + Intronic
1140703559 16:77605042-77605064 AGGGAGAAAAACTATGATGCAGG - Intergenic
1141014590 16:80437148-80437170 AGCAAGAAGCATTATGGGGCTGG + Intergenic
1142379048 16:89721501-89721523 AGCGAGAAGCAAAGCGAGGCGGG - Intronic
1203125482 16_KI270728v1_random:1574769-1574791 AGGAAGACGGATTATGAGGCAGG - Intergenic
1144837058 17:18162013-18162035 AGAGAGAAGCATTCAGAGGCAGG - Intronic
1145940702 17:28742010-28742032 GAGGAGAAGCAATATCAGGGTGG - Exonic
1146876692 17:36419246-36419268 AGACAGAAAGAATATGAGGCAGG - Intronic
1147062692 17:37893615-37893637 AGACAGAAAGAATATGAGGCAGG + Intergenic
1147253472 17:39167192-39167214 AGGGAGAAGCCCCATGTGGCTGG - Intronic
1148024625 17:44578056-44578078 AGGAGGAAGCAATTTGAGGCAGG - Intergenic
1150221984 17:63500943-63500965 AGGGAGAGGCAACATGGGGAGGG - Intronic
1150808943 17:68341387-68341409 AGGGAGAAACAGTATGTGGAGGG - Intronic
1151243433 17:72776004-72776026 AGGGAGAGGGAACATGTGGCAGG - Intronic
1156490214 18:37491647-37491669 AGGGAGAAGGAGTGTGTGGCAGG + Intronic
1157531676 18:48426478-48426500 GGGGAGAGGCAATTTGAGGATGG - Intergenic
1157746875 18:50143661-50143683 AGGTAGAAGGAATAGAAGGCAGG + Intronic
1158031694 18:52973474-52973496 AGGGAGCAGAAATATGAGAAAGG - Intronic
1158279601 18:55808508-55808530 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1158306866 18:56115654-56115676 GGGAAGAAGCAAGTTGAGGCAGG - Intergenic
1161712293 19:5855707-5855729 AGGTAAAAGCAAAAAGAGGCTGG - Intergenic
1162461328 19:10815913-10815935 AGGGAGAAGCAAAGAGAGGCGGG + Intronic
1162841950 19:13363297-13363319 AGAGAGAATGAATATGGGGCAGG - Intronic
1162991757 19:14307416-14307438 GGGGAGAAGAAAAATGAGACAGG - Intergenic
1164418341 19:28065138-28065160 AGAGAGAAGCTCTATGAGGTTGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166631354 19:44410457-44410479 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1167276519 19:48543441-48543463 AGGGATGAGCAAGATGAGGGTGG + Intergenic
1167497366 19:49827500-49827522 AGGGAGAGGCCATGTGAGGACGG - Intronic
1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1202649372 1_KI270706v1_random:166431-166453 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
925355519 2:3238493-3238515 AGAGAGAAGGAATGTGAGGAAGG - Intronic
926167754 2:10532116-10532138 AGGGAGGAGAAATCTGAGCCGGG - Intergenic
926874392 2:17458518-17458540 AGGAAGAAGCATTATGAAGATGG + Intergenic
927220332 2:20701860-20701882 ATGGAGAAGCCAGATGAGGTTGG - Intronic
927393281 2:22620511-22620533 AGGGAGAAACTAGATGAGGATGG + Intergenic
927582242 2:24262529-24262551 AGGGAGAAACACTGTGAGGATGG - Intronic
928310399 2:30204923-30204945 AGGGAAAAGCAACATGTGCCTGG - Intergenic
928332893 2:30371153-30371175 AGGGTGAAAAAAAATGAGGCTGG + Intergenic
928334295 2:30382929-30382951 AGGGAGAAGAGATGGGAGGCAGG - Intergenic
928385481 2:30863942-30863964 ATGGAGCAGAAATATGAGGCAGG + Intergenic
929046915 2:37799108-37799130 AGGGAGAAGCAATCTAAGCATGG - Intergenic
929683212 2:44011963-44011985 TGGGAGAAGCAGTTTGAGTCAGG - Intergenic
929868832 2:45740772-45740794 AGGTAGAATCAGAATGAGGCAGG - Intronic
929960656 2:46493922-46493944 TGGGAGCAGGAAAATGAGGCGGG + Intronic
930218980 2:48726416-48726438 AGGTAGAGATAATATGAGGCAGG + Intronic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
934629148 2:95896800-95896822 AGGGAGATGGATTGTGAGGCAGG - Intronic
934629564 2:95902416-95902438 AGGGAGACGGATTGTGAGGCAGG - Intronic
934973506 2:98783330-98783352 AGGGAGAAGGAATATGATAAAGG + Intergenic
935099107 2:99975592-99975614 AGGAGGAAGCAGTAGGAGGCAGG + Intronic
937119572 2:119432121-119432143 CGGGAGCAGCTATGTGAGGCAGG - Intronic
937643938 2:124244624-124244646 AGGGAGAAGTGATTTGAGGAGGG + Intronic
937709979 2:124969407-124969429 AGGAAGAAGGAAAATAAGGCAGG - Intergenic
938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
939031563 2:137081949-137081971 AGGGAGAAGAAATTAGAGGAGGG - Intronic
940301774 2:152182778-152182800 AGAGAGAAAGAATATGATGCAGG - Intergenic
941172778 2:162159990-162160012 ATGAAGAGGCAAGATGAGGCTGG + Intergenic
941283587 2:163581970-163581992 AGGAAGAAAACATATGAGGCTGG + Intergenic
942131568 2:172885281-172885303 AGGGAGGAGGAAAGTGAGGCAGG - Intronic
942131573 2:172885301-172885323 AGGGAGGAGGAAAGTGAGGCAGG - Intronic
943163959 2:184293102-184293124 ACTGGGAAGCTATATGAGGCTGG + Intergenic
943664908 2:190599209-190599231 AGAGAGAAGCTATAAAAGGCAGG + Intergenic
944090509 2:195904700-195904722 AGGGAGCAGCAAGGTGTGGCAGG + Intronic
945043956 2:205765622-205765644 TGGGATAAGCAAGAGGAGGCAGG + Intronic
945668767 2:212776480-212776502 AGGGAGATGCAATTTAAAGCAGG - Intergenic
945851258 2:215010452-215010474 AGGGAGAAGCAAAATGGTGCTGG + Exonic
946226604 2:218267204-218267226 AGGGGGAAGGCATAGGAGGCTGG - Intronic
947182303 2:227422010-227422032 ATTAAGAAGCAAAATGAGGCTGG - Intergenic
948004755 2:234597892-234597914 AGGAAGAAGGAATATGAATCAGG + Intergenic
948131691 2:235605514-235605536 AGGGAGAAGATAAATGATGCCGG - Intronic
948295135 2:236855157-236855179 TGGGAGAAGGAGGATGAGGCAGG - Intergenic
948512269 2:238476517-238476539 AGAGAGGAGCAAAATGAGGCCGG + Intergenic
948642787 2:239386007-239386029 AGGGAGAAGGAATCTGGGTCGGG + Intronic
948747961 2:240109589-240109611 AGGGAGCTGGAACATGAGGCCGG - Intergenic
949029452 2:241785077-241785099 AGGGAGAATTATTATGAGGCTGG + Intronic
1168833685 20:862157-862179 AGGATGAAGCAACATGAGGCTGG + Intergenic
1168860330 20:1041716-1041738 AGGGAAGAGCCATAGGAGGCAGG - Intergenic
1168910065 20:1440485-1440507 AGAGAGAAGAAAAATGAAGCAGG + Intergenic
1173255221 20:41389994-41390016 AGGGAAAACAATTATGAGGCAGG - Intergenic
1173670993 20:44798815-44798837 AGGGAGACGCAGCATGGGGCAGG - Intronic
1174775681 20:53341165-53341187 AAGGACAAGCAAACTGAGGCAGG - Intronic
1174983900 20:55428040-55428062 GGGGAGTGGCAACATGAGGCTGG + Intergenic
1175155294 20:56967287-56967309 ACGGAGAAGAAAGAGGAGGCTGG - Intergenic
1175212528 20:57370016-57370038 AGGGAGAAGTACTACGCGGCAGG - Intronic
1175254913 20:57636128-57636150 AGGGAGAAGAAAAATGATGTAGG + Intergenic
1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1176602928 21:8809384-8809406 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1176611894 21:8991218-8991240 AGGGAGAAGCTGGCTGAGGCAGG - Intergenic
1179033110 21:37737182-37737204 AGAGAGAGGCAATATGAAACAGG - Intronic
1179063063 21:37997608-37997630 ATGGAGGAGCTATATGAGCCAGG - Intronic
1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180345214 22:11700941-11700963 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180352994 22:11819182-11819204 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180385698 22:12175695-12175717 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1182464260 22:30504818-30504840 TGGGATTAGAAATATGAGGCCGG + Intronic
1183868831 22:40725226-40725248 AAGGAGAAGGAAGATGAGGGTGG - Intergenic
950114979 3:10444873-10444895 AGGAAGAAGAAAGAAGAGGCAGG - Intronic
950404612 3:12796890-12796912 AGGGAGAAGAGAGAAGAGGCAGG - Intronic
950867999 3:16204786-16204808 GGGGAGAAGCAATGTGGGGCAGG + Intronic
954112937 3:48445900-48445922 AAGGAGCAGCAATTTGAGGTGGG - Intergenic
954807202 3:53227397-53227419 AGGCAGGAGCAAGATGGGGCTGG - Intronic
954971420 3:54654600-54654622 GGGGAGAAGCTCTATCAGGCTGG + Intronic
955544683 3:60015590-60015612 AGGGAGGAGGAATATGGGGAAGG - Intronic
956377815 3:68634548-68634570 AGAGAGGAACAAGATGAGGCTGG - Intergenic
956737619 3:72250195-72250217 GGGGAGAAGCAGGAGGAGGCTGG + Intergenic
957376004 3:79358299-79358321 AGGGAAATGCAATATGATTCAGG + Intronic
958572192 3:95900157-95900179 AGGAAAAAGCCATATGAGGGAGG - Intergenic
959228803 3:103620196-103620218 GGGCAGAAGCAATATGCCGCTGG + Intergenic
959397605 3:105860637-105860659 AGGGAGAAGAAATATTAAGAAGG - Intronic
959871059 3:111329009-111329031 ATAGAGAAGCAATATAATGCAGG - Intronic
960493740 3:118350598-118350620 AGGGAGAAGTCATATGACACAGG - Intergenic
961265052 3:125634927-125634949 GGGGAGAAGGAAGATGGGGCAGG + Intergenic
961929973 3:130522895-130522917 AGGGAGGGGCACTAGGAGGCCGG - Intergenic
962070589 3:132029565-132029587 GGGGAGGAGCAAAATCAGGCTGG - Intronic
963111235 3:141689839-141689861 AAGAAGAAGCAACACGAGGCTGG + Intergenic
964713755 3:159699531-159699553 AGGGAGAACCAAGATTATGCTGG + Intronic
966861601 3:184233676-184233698 AAGGAGAAGGTATATGGGGCAGG - Exonic
967735315 3:192945566-192945588 AAGGAAAAGTAATGTGAGGCAGG - Intergenic
967817749 3:193813497-193813519 AGGGAGAGGCAATAGGGGACTGG + Intergenic
968324188 3:197797955-197797977 AATGAGAAGCAATCTGAAGCTGG + Intronic
971521981 4:27565148-27565170 AGGGAGAAGCCATTTTAGCCTGG + Intergenic
971854362 4:32024735-32024757 AGGGAGAATAAATGTGAGGTAGG - Intergenic
972627183 4:40811268-40811290 GGATAAAAGCAATATGAGGCCGG + Intronic
972652230 4:41029268-41029290 AGGGAGAAGCTAAATAAAGCTGG + Intronic
973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973379431 4:49310058-49310080 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973380304 4:49316054-49316076 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973381227 4:49322220-49322242 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973382312 4:49329265-49329287 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973385851 4:49513877-49513899 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
974162403 4:58156884-58156906 AGAGACAAGCAAGCTGAGGCTGG - Intergenic
974348516 4:60714505-60714527 AGGGATAATGAAAATGAGGCAGG - Intergenic
974380494 4:61133928-61133950 ATGGAGAAGCAATTAAAGGCTGG + Intergenic
974568706 4:63613686-63613708 AGGGAGAAGCAATATTTGCTAGG + Intergenic
976379057 4:84378882-84378904 AATGAGAAGGAAGATGAGGCTGG + Intergenic
977076633 4:92460390-92460412 AGGGAGAAGTAAAGAGAGGCTGG - Intronic
977350966 4:95886338-95886360 AGGGAGGAGCAAGAAGAAGCAGG + Intergenic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
977698965 4:99999510-99999532 AGGGGGAAGAAATGTCAGGCAGG + Intergenic
977705288 4:100063984-100064006 AGGCACAAGCAAGATCAGGCAGG + Intergenic
978357215 4:107889977-107889999 AGGGAGAATTTTTATGAGGCTGG + Intronic
980988501 4:139718376-139718398 AAGGAGAAGCAAGGGGAGGCTGG + Exonic
981263697 4:142754974-142754996 AGGCAGGTGCAATATGAGGCAGG - Intronic
986614386 5:9601642-9601664 AGGGAGTGGAAATATGAGTCAGG - Intergenic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
988350580 5:30101059-30101081 AGGAAGAGGCAATATGATGATGG - Intergenic
989159057 5:38372453-38372475 AAAAAGAAGCAGTATGAGGCCGG - Intronic
989652106 5:43702365-43702387 AGGGAGAAGCATAATAATGCAGG + Intronic
989677829 5:43992959-43992981 AGGGAGAAACACTATGAGTTGGG + Intergenic
990363143 5:55042150-55042172 AGGCAGAAGAAACAAGAGGCTGG + Intergenic
992027428 5:72684444-72684466 AGGAAGCAGAAATGTGAGGCAGG + Intergenic
993290579 5:86063044-86063066 AGGTAGAAGAAATGTGAGGAAGG - Intergenic
993384658 5:87250775-87250797 AGGGAAAAGCAAATTGAGGAAGG - Intergenic
994650958 5:102527626-102527648 TGGGAGAAGAAATACTAGGCAGG - Intergenic
995696605 5:114884976-114884998 TGGGAAAAGCAATATGAGAAAGG - Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
999088404 5:148913315-148913337 AGGATGAAGCAGCATGAGGCAGG - Intergenic
999296537 5:150462959-150462981 AGGGAGAAGGGAGATGAGGTGGG + Intergenic
999889364 5:155960116-155960138 AGGGAGAAGAAAAAGGAGGGAGG - Intronic
999902796 5:156104444-156104466 AGTGAGATTCAATATCAGGCAGG - Intronic
1001260051 5:170220640-170220662 AGGAAGAAGCACTTTGAAGCAGG + Intergenic
1001587123 5:172840534-172840556 TGGGAGAAGCAATAGCAAGCAGG + Intronic
1002815024 6:671560-671582 AGGGAGAAGCAAAATGATATAGG - Intronic
1004455877 6:15790983-15791005 AGGGAGAAGCAATGCTTGGCAGG + Intergenic
1005221274 6:23591674-23591696 AGGGAGAAAAAAAATGACGCTGG + Intergenic
1007226780 6:40320798-40320820 AGGAAGAAGCAGCATGAGTCTGG + Intergenic
1007230705 6:40345852-40345874 ACGGAGGAGCCATCTGAGGCTGG - Intergenic
1009588322 6:65635393-65635415 AGGGAAAGGCAAGATGGGGCGGG - Intronic
1009951836 6:70406054-70406076 AGGTAGAAGGAATCTTAGGCAGG + Intergenic
1011819157 6:91230257-91230279 AGGGAGAAGCATTATTACACAGG - Intergenic
1013233432 6:108176349-108176371 AGGGAGAGGGAATCTGAGGGAGG - Intronic
1013467485 6:110430340-110430362 AGGGAGAATGTACATGAGGCTGG + Intronic
1013862457 6:114652218-114652240 AGGGAGAAGCAGAATTGGGCAGG - Intergenic
1016110574 6:140218757-140218779 GGGGAGAAGCCATGTGAAGCTGG + Intergenic
1016827980 6:148405594-148405616 AGAGCCAAGCAATATGAGGAGGG - Intronic
1016989393 6:149918856-149918878 AGGGAGAAGGAAGAGGAGGGTGG + Intronic
1017004591 6:150020718-150020740 AGGGAGAAGGAAGAGGAGGGTGG + Intronic
1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG + Intergenic
1019372472 7:670261-670283 AGGGAGGAGGAATATGAAGTGGG - Intronic
1019446935 7:1076259-1076281 AGGGAGGAGCACCATGAGGGAGG + Intronic
1019450900 7:1097279-1097301 AGGGAGAGACAAGATGAGCCTGG + Intronic
1020126247 7:5533957-5533979 AGGGAGGGGCAGTGTGAGGCAGG - Intronic
1020190027 7:5988450-5988472 AGGGAGAATGAGAATGAGGCAGG + Intronic
1020292895 7:6736225-6736247 AGGGAGAATGAGAATGAGGCAGG - Intergenic
1021629610 7:22631602-22631624 ATGGAAAACCAATATGAAGCAGG - Intronic
1022818694 7:33937903-33937925 AGGGTGATGGAAAATGAGGCTGG - Intronic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1024673024 7:51613772-51613794 AGGCAGAAGAAATAAGATGCAGG - Intergenic
1024906812 7:54392478-54392500 AGGGAGAATTATTATGAGGCTGG + Intergenic
1027167258 7:75843832-75843854 AGGGCTAAGAAAAATGAGGCTGG - Intronic
1027472618 7:78592031-78592053 AGAGAAAAGAAATATGAGGGAGG + Intronic
1027501521 7:78957847-78957869 AGGGAGCAGCAGCATCAGGCTGG - Intronic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1028304149 7:89241145-89241167 ACGTAGAAGAGATATGAGGCTGG + Intronic
1029263679 7:99322280-99322302 AGGGGGAAGCAAAAAGAAGCAGG + Intergenic
1030114982 7:106056056-106056078 AGGAAGAAGCAACTTGAGGCCGG + Intergenic
1030177110 7:106665948-106665970 GAGGAGAAAAAATATGAGGCTGG + Intergenic
1030409500 7:109157665-109157687 GGTGAGAATCAATATGAGGCAGG + Intergenic
1030652478 7:112130245-112130267 GGGGAGAGCCAATATGAGCCTGG + Intronic
1031020860 7:116626085-116626107 AGGGAGAAGTAATGGGAGGTTGG - Intergenic
1031366385 7:120905239-120905261 AGGGAGAATCAATATGAAAATGG + Intergenic
1031666929 7:124496103-124496125 AGGGAGAATCAATATGAAAATGG - Intergenic
1031873927 7:127116688-127116710 AGTGAGAGGCAATCTGTGGCTGG - Intronic
1032995603 7:137442744-137442766 AGGGAGAAGGAGTTTTAGGCTGG - Intronic
1033537933 7:142329026-142329048 AGGGAGAGACAACATGAGGGTGG - Intergenic
1033981582 7:147171242-147171264 AGGCTGAAGCAAGAGGAGGCTGG - Intronic
1034346495 7:150388505-150388527 AGAGAGAAGAAAGAGGAGGCAGG + Intronic
1037645669 8:20790623-20790645 AGGGAGAAATAATATGAAGGAGG - Intergenic
1037703843 8:21298438-21298460 GGGGAGAAGCAGTATCAGGAGGG - Intergenic
1038115228 8:24546429-24546451 TGGGAGATGCAAGAAGAGGCTGG + Intergenic
1038347574 8:26746515-26746537 GGAGAGAAGAAATATGATGCTGG + Intergenic
1040577669 8:48667880-48667902 AGGGAGAAGGAAGAAGAGACAGG - Intergenic
1040861568 8:52005031-52005053 GGGGAAAAGCCATAGGAGGCTGG + Intergenic
1044357188 8:91236228-91236250 AATGAAAAGCAATTTGAGGCTGG + Intronic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1044535963 8:93356796-93356818 AGGAAGAAGGAACATGAAGCTGG - Intergenic
1044559347 8:93597187-93597209 AGGGAGAAGGAAGATGTCGCAGG - Intergenic
1045475978 8:102553064-102553086 TGGAAAAAGCAATAGGAGGCCGG + Intronic
1046869826 8:119193488-119193510 AGGGAGAAGCATTTTGAAGCAGG + Intronic
1047680267 8:127247571-127247593 AGGGAGAAGCATCTGGAGGCTGG + Intergenic
1047791842 8:128211235-128211257 AGGGAGAAACTATATGAAGCTGG + Intergenic
1048079187 8:131106447-131106469 ATGGAGAAGCAATAAGAGAAGGG - Intergenic
1048200427 8:132369510-132369532 AGGGAGTATAAAAATGAGGCTGG + Intronic
1048519697 8:135142110-135142132 AGGGAGAAGGAATAGAAGGAAGG + Intergenic
1048596101 8:135868050-135868072 AGGAAGAAACAATATGATGTTGG - Intergenic
1048893705 8:138969723-138969745 AGTGAGAGGCAATGTGAAGCAGG + Intergenic
1052334580 9:27306602-27306624 AGGGAGATAGAATATGAGGCTGG - Intergenic
1052915783 9:33923510-33923532 AGGAAGAGGCAAGCTGAGGCTGG + Intronic
1055407139 9:75987169-75987191 AGGCAGAAGGAATGGGAGGCAGG - Intronic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1055664890 9:78543497-78543519 AGGGAGAAGAGAAATGAAGCGGG - Intergenic
1060739125 9:126086391-126086413 AGAGAGAAGCAAAATTAGCCTGG - Intergenic
1061763718 9:132868505-132868527 AGGGAGAAGGAGTGGGAGGCTGG - Intronic
1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203549457 Un_KI270743v1:155639-155661 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203550415 Un_KI270743v1:161951-161973 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1187245872 X:17552527-17552549 AGGGAGAAAGAAGATGAGGAAGG + Intronic
1187288559 X:17930233-17930255 AGGGAGAAGAAACAGTAGGCAGG + Intergenic
1189157839 X:38777761-38777783 AGTGAGAAGCAAGATGAGACTGG + Intergenic
1190329270 X:49225857-49225879 GGGTAGAAGGAATAGGAGGCTGG + Intronic
1191909764 X:66136887-66136909 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1191976238 X:66874708-66874730 AGGGAGAAGCAAGGTGAGATTGG + Intergenic
1192079194 X:68031297-68031319 AGAGAGAAGCAATATCCTGCTGG + Intergenic
1192601620 X:72470402-72470424 AGGTAGAAGAAATATGATGGAGG - Intronic
1193325358 X:80173380-80173402 AGGCAGAAACTATGTGAGGCAGG + Intergenic
1196842199 X:119869227-119869249 AGGGAGATGGAACACGAGGCCGG - Intergenic
1196943269 X:120798637-120798659 AGGGAGAAGCAATGTCAGGATGG + Intergenic
1197872225 X:131071241-131071263 AGGGAGCAGCAGTTTGAGGCTGG - Intronic
1199372921 X:147072782-147072804 ATGGAGAAGGAATATGGGGAAGG + Intergenic
1199666058 X:150097448-150097470 AGGCAGAAGGAATCTGAGGTAGG - Intergenic