ID: 1022834079

View in Genome Browser
Species Human (GRCh38)
Location 7:34097178-34097200
Sequence CAAAAAGAGGAGCAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022834074_1022834079 5 Left 1022834074 7:34097150-34097172 CCAAAAGCATATGTAGGGTTTAG 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG No data
1022834071_1022834079 11 Left 1022834071 7:34097144-34097166 CCAAAACCAAAAGCATATGTAGG 0: 1
1: 0
2: 1
3: 13
4: 218
Right 1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022834079 Original CRISPR CAAAAAGAGGAGCAGGAGGC TGG Intronic
No off target data available for this crispr