ID: 1022834967

View in Genome Browser
Species Human (GRCh38)
Location 7:34104646-34104668
Sequence CTAGAGTCAGACTGTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 142}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022834967_1022834974 4 Left 1022834967 7:34104646-34104668 CCAACAAAACAGTCTGACTCTAG 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1022834974 7:34104673-34104695 GAAACGTGGGTGTGGCATGGTGG 0: 1
1: 0
2: 1
3: 30
4: 289
1022834967_1022834971 -9 Left 1022834967 7:34104646-34104668 CCAACAAAACAGTCTGACTCTAG 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1022834971 7:34104660-34104682 TGACTCTAGGGTTGAAACGTGGG 0: 1
1: 0
2: 0
3: 7
4: 50
1022834967_1022834975 8 Left 1022834967 7:34104646-34104668 CCAACAAAACAGTCTGACTCTAG 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1022834975 7:34104677-34104699 CGTGGGTGTGGCATGGTGGCTGG No data
1022834967_1022834972 -4 Left 1022834967 7:34104646-34104668 CCAACAAAACAGTCTGACTCTAG 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1022834972 7:34104665-34104687 CTAGGGTTGAAACGTGGGTGTGG No data
1022834967_1022834970 -10 Left 1022834967 7:34104646-34104668 CCAACAAAACAGTCTGACTCTAG 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1022834970 7:34104659-34104681 CTGACTCTAGGGTTGAAACGTGG No data
1022834967_1022834973 1 Left 1022834967 7:34104646-34104668 CCAACAAAACAGTCTGACTCTAG 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1022834973 7:34104670-34104692 GTTGAAACGTGGGTGTGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022834967 Original CRISPR CTAGAGTCAGACTGTTTTGT TGG (reversed) Intronic
901665298 1:10822861-10822883 TTAGAATCAGACAGGTTTGTAGG - Intergenic
903293249 1:22327936-22327958 CTAGAGTCAGCCTGGGTTCTGGG + Intergenic
903666339 1:25009774-25009796 CCAGAGACAGACTTTGTTGTGGG + Intergenic
904071338 1:27800145-27800167 CTCTAGACAGACTGTTTGGTTGG - Intronic
907495510 1:54841612-54841634 TTAGAATCAGGCTGTTTTGTTGG + Intronic
907818264 1:57941344-57941366 CTAGAGTCTCACTTTTTTGTAGG + Intronic
908285650 1:62596308-62596330 CTGGAGTCAGACTGTGGTGTGGG - Intronic
908927084 1:69268846-69268868 CTAAGGTCAGAATGATTTGTGGG - Intergenic
910451932 1:87356036-87356058 CAAGAGTCAGGCTGTTTTTATGG - Intergenic
910747639 1:90590970-90590992 CTAAAGTCAGAGTGGGTTGTGGG - Intergenic
914411371 1:147431402-147431424 CTTGAGTCAGTCTTTTTGGTAGG + Intergenic
916199744 1:162258764-162258786 CCAGTGTTAGACTGGTTTGTGGG - Intronic
916720927 1:167484299-167484321 CTATAGGCTGACTGTGTTGTGGG + Intronic
916906262 1:169288071-169288093 CTTGAGTCAGAGGGTTTTATAGG - Intronic
918911687 1:190580885-190580907 CTACAGTCATCCTGTTTTGCTGG + Intergenic
919375921 1:196794900-196794922 CTAGACTGAGAATGTTTTGGTGG + Intronic
919814354 1:201428304-201428326 GGAGAGGCAGCCTGTTTTGTGGG - Intronic
920969446 1:210730606-210730628 CTGGAGTCTTACTATTTTGTGGG + Intronic
923370435 1:233306069-233306091 AGAGAGTTAGAGTGTTTTGTGGG + Intergenic
924644597 1:245866105-245866127 CCAGAGTCAGTCTGTGTTTTTGG + Intronic
924809542 1:247389077-247389099 CGAGAACGAGACTGTTTTGTTGG - Intergenic
1069336580 10:67358676-67358698 CAAGAGTCAGAATGGGTTGTGGG - Intronic
1072544467 10:96424246-96424268 CTATAGTCACTCTGTTTTTTTGG - Intronic
1073518584 10:104102507-104102529 TTAGACTCTGAATGTTTTGTGGG + Intergenic
1075774824 10:124975985-124976007 ACAGAGTGAGACTGTCTTGTGGG + Intronic
1079089104 11:17468328-17468350 CTTAAGTCAGACTGATTTTTAGG - Intronic
1079502918 11:21122040-21122062 CTAGTGTTTGATTGTTTTGTTGG + Intronic
1082079573 11:48001795-48001817 CCAGAGTCAGAGTGTTAGGTAGG + Intronic
1085229922 11:74957844-74957866 CTAAAGTCTGACTGAATTGTTGG - Intronic
1085968622 11:81559590-81559612 CTTGTATCAGATTGTTTTGTAGG + Intergenic
1086396637 11:86422342-86422364 GTAGGGTCAGACTGTTGTGAAGG + Intronic
1087200470 11:95339580-95339602 CTAGTTTCAAACTGTTTTGCTGG + Intergenic
1087374833 11:97327224-97327246 CTAGATTCAGCCTCTTTTCTAGG + Intergenic
1087386072 11:97470646-97470668 GTATAGTCATATTGTTTTGTGGG - Intergenic
1087386165 11:97471536-97471558 CTAGAGGCTGACTGGTCTGTGGG - Intergenic
1091205360 11:133817363-133817385 CTATCATCAGACAGTTTTGTAGG - Intergenic
1091235005 11:134015755-134015777 CTTGATCCAGACTGTTCTGTGGG + Intergenic
1093929019 12:24936608-24936630 CTAGAGTGAGAATGTTTTCTTGG + Intronic
1096567580 12:52494189-52494211 CAAGAGTCAGACAGTTTAATTGG + Intergenic
1096834067 12:54337185-54337207 GTATAGGCAGATTGTTTTGTGGG - Intronic
1097185402 12:57193895-57193917 CTAGAGACAGCCTGTGGTGTGGG + Exonic
1097521239 12:60673078-60673100 CTAGAGTCAGCCTCCTTTCTAGG + Intergenic
1100810050 12:98328552-98328574 TCAGAGTCAGACTGTTTGATGGG - Intergenic
1114164618 14:20208112-20208134 CTAGATTCTGACTTTCTTGTAGG + Intergenic
1116052254 14:39819278-39819300 CGAGAGTCAGACAGTTTCATGGG - Intergenic
1116185431 14:41594745-41594767 CTATAATCAAAATGTTTTGTTGG - Intergenic
1117073899 14:52081613-52081635 ATAGAGTCAGTCTCTTTTTTAGG + Intergenic
1117556264 14:56888136-56888158 TTACAGTGAGACTGTTTTGGTGG - Intergenic
1119705121 14:76778505-76778527 CAAGAGTCAGAGTGATGTGTAGG - Intronic
1120671044 14:87363266-87363288 CTAGAGTCAGACTCTGTGATAGG - Intergenic
1121439929 14:93942162-93942184 GAAGAGTCAGACTGTTTGGTGGG - Intronic
1122200215 14:100118048-100118070 TTAAAGTCAGGCTGTTCTGTTGG + Intronic
1127065971 15:55238955-55238977 CCAAAGTCAGAAAGTTTTGTAGG - Intronic
1137752588 16:50877844-50877866 CTTGTGTGGGACTGTTTTGTAGG + Intergenic
1138293174 16:55865394-55865416 CTAAAGTCAGACTGCTTTGCAGG + Intronic
1139846779 16:69927115-69927137 CTAGACTATGACAGTTTTGTGGG - Intronic
1140589873 16:76338710-76338732 CTGGAGACAGACTGTTTTCAGGG + Intronic
1142331800 16:89459427-89459449 TTAGAGTTAGTCTTTTTTGTTGG - Intronic
1142851427 17:2706625-2706647 CTAGAGTCAGGCAGGTGTGTGGG - Intronic
1143413892 17:6730820-6730842 CTAGAGGTAGTCTTTTTTGTGGG - Intergenic
1149047143 17:52259897-52259919 CTAGATACTGACTGTTTTGTAGG + Intergenic
1155348599 18:24883779-24883801 CTCCAGTCAGGCTGTTTGGTGGG + Intergenic
1157777552 18:50407605-50407627 CTAGAGTCAGGGTGATTTTTAGG - Intergenic
1158425214 18:57333975-57333997 GTAGAGCCAGACTTTTTTCTGGG - Intergenic
1158439889 18:57466340-57466362 CTGCAGTCAGTCTGTTTTGGGGG - Intronic
1159677004 18:71297396-71297418 GTAGAGTAAGAATTTTTTGTTGG + Intergenic
1162911818 19:13851644-13851666 ATTGAGTCAGACTGTCTGGTGGG + Intergenic
1164966347 19:32488048-32488070 CTAGTTTCAGTCTGTTTCGTTGG - Intergenic
1168681005 19:58315873-58315895 CTAGAGCCACACTGATGTGTAGG + Intergenic
925107520 2:1305583-1305605 CTATGATAAGACTGTTTTGTGGG + Intronic
926315075 2:11703783-11703805 CTTGAGTCAGTTTGTTTTGGAGG - Intronic
926381852 2:12298941-12298963 CTAGAGTGAGAATGGTTTGATGG + Intergenic
926838740 2:17054109-17054131 CTAAAGGCAGACAGTTTTGGTGG - Intergenic
928058234 2:28081096-28081118 CTATAGGAAGATTGTTTTGTAGG - Intronic
930354849 2:50305070-50305092 ACAGAGCCAGACTGTCTTGTAGG + Intronic
935202753 2:100872231-100872253 CTGGAATCAGACTGCTTAGTTGG + Intronic
940204546 2:151188410-151188432 CTGGAGTCAGACTGTTGGCTTGG - Intergenic
945292628 2:208140974-208140996 CTAGATTCTGACTGTTTTTCAGG + Intergenic
945797702 2:214385449-214385471 CTAGAGTCAGAATGCCTTGGTGG - Intronic
946413741 2:219528914-219528936 CTAGAGTCGGGCTGTCTTGCTGG + Intronic
947636799 2:231684372-231684394 CTAGAGTCTGACTGGCCTGTTGG + Intergenic
947655035 2:231819696-231819718 CTGGAGTCACACTGCTTTTTTGG + Intergenic
1174534739 20:51242394-51242416 CTAGACCCAGATGGTTTTGTAGG - Intergenic
1177753439 21:25315661-25315683 TTAAAGTCTGACTGCTTTGTTGG - Intergenic
951066841 3:18276750-18276772 CCAGACCCAGAGTGTTTTGTTGG + Intronic
951702788 3:25512788-25512810 TCAGAGTCAAACTGTTTTTTGGG + Intronic
951932855 3:27988898-27988920 CCAGAGTCAGCCTGGTGTGTGGG - Intergenic
953603251 3:44388440-44388462 TTAGAGTCAGAGTTTTTTGCAGG + Intronic
954502281 3:51029733-51029755 CCAGAGTCAGAGTGGGTTGTGGG + Intronic
955365622 3:58307420-58307442 CTAGAGTCAGCCTTTTTTAGTGG - Intronic
956965801 3:74458572-74458594 TTAGAGTCTGACTCCTTTGTGGG - Intronic
957275669 3:78088236-78088258 CTTAAGTCAGACTGTATTCTAGG - Intergenic
962607575 3:137045258-137045280 CTGGAGTCTTGCTGTTTTGTGGG + Intergenic
978561405 4:110037590-110037612 CTTGAGTCTCATTGTTTTGTAGG + Intergenic
979070725 4:116202778-116202800 CTTGAGTCAGAACTTTTTGTAGG + Intergenic
979205976 4:118038493-118038515 CTAGAGACAGAGTGTATTCTTGG + Intronic
979424017 4:120542850-120542872 AGAGAGTCATAATGTTTTGTGGG + Intergenic
979864961 4:125742741-125742763 CTAAATTCAGAGTGTTTTGGGGG + Intergenic
981214212 4:142145001-142145023 GTTGAGTCAGACTTTTTTGCTGG - Intronic
981578303 4:146227614-146227636 TTAGAGTCAGATTCTTTTCTGGG - Intronic
981636018 4:146880093-146880115 ATAGAGCCAAAATGTTTTGTTGG + Intronic
981692332 4:147523432-147523454 CTACAGAGAGTCTGTTTTGTTGG + Intronic
982552160 4:156816144-156816166 CTAGAAACAGCCTGTTTTGCAGG - Intronic
985038042 4:185861117-185861139 CTATAAACAGTCTGTTTTGTCGG + Intronic
985209931 4:187581785-187581807 TTATAGTCTGACTGTTATGTTGG - Intergenic
987061642 5:14249099-14249121 CTGGAGGCAGACTGACTTGTCGG + Intronic
987605826 5:20134834-20134856 TTAGAGTCAGATTGGTTTGGTGG + Intronic
988805636 5:34737946-34737968 TTAGAGTCATTCTGTTTTGCAGG + Intronic
991041737 5:62183059-62183081 CAAAAGTCAAACTGTTTAGTGGG + Intergenic
994069380 5:95581763-95581785 CCAGTGTCAGATTGTTTTGATGG + Intronic
997464830 5:134080255-134080277 CTAGAAATAGTCTGTTTTGTGGG - Intergenic
998070029 5:139190581-139190603 CTAGAGTCCCACTATTATGTGGG + Intronic
999424381 5:151474373-151474395 CTAGAGTCAGACTGACATGGGGG + Intronic
1000599244 5:163252342-163252364 CTAGAGACAGAATGTTATGATGG - Intergenic
1001668799 5:173456491-173456513 GTATAGTCAGACTCTTTTTTTGG - Intergenic
1001887551 5:175309136-175309158 TTAGAGTCTGACTGGTTTCTAGG - Intergenic
1003750699 6:9052017-9052039 CTAGAGACAGACTGATTTATAGG + Intergenic
1004383276 6:15150530-15150552 CAAGATTCACACAGTTTTGTTGG - Intergenic
1005573789 6:27173020-27173042 CAAGAGTCAGACTGTGTGGTGGG + Intergenic
1006532410 6:34667726-34667748 TTAGAATCAGATTATTTTGTTGG - Intronic
1009438723 6:63650151-63650173 CTACAGTATGTCTGTTTTGTTGG - Intronic
1011043401 6:83055843-83055865 CTTGAATCAAACTGTTTTGTAGG - Intronic
1011347902 6:86391838-86391860 CTAGTGTGAGACTCTTTTGAGGG - Intergenic
1012570491 6:100720493-100720515 CTTGAGGCAGAATGTGTTGTTGG - Intronic
1019818004 7:3215505-3215527 CTAGGGTCAGAGTCTGTTGTTGG - Intergenic
1022834967 7:34104646-34104668 CTAGAGTCAGACTGTTTTGTTGG - Intronic
1023245091 7:38194017-38194039 CTGGAGTCAGACAGTTTTATGGG - Intronic
1028010425 7:85636143-85636165 CTAGTGACCGAGTGTTTTGTTGG + Intergenic
1031758474 7:125678643-125678665 ATAGATTGAGAATGTTTTGTAGG + Intergenic
1032225075 7:130024720-130024742 CTATGGTAAGACTGTTTTGCAGG + Intronic
1032349538 7:131147699-131147721 CTAAAGTCAGACTGTGTGGGTGG - Intronic
1033497795 7:141917093-141917115 CTAGTGTCAGACTCTGTTCTTGG + Intronic
1034540373 7:151754544-151754566 CCAGAGTCAATCTTTTTTGTCGG + Intronic
1035887783 8:3310428-3310450 CTAGAGGCAGAATGACTTGTTGG + Intronic
1045295309 8:100867415-100867437 TTAGAGTCAGAAGGTTTTGGAGG - Intergenic
1046052048 8:109035386-109035408 CTAGATTCAGATAGTTTTATAGG + Intergenic
1047618717 8:126585039-126585061 CTGGAGTCAGCCTGTATTGTTGG - Intergenic
1048261118 8:132945897-132945919 CTAAAATGAGAATGTTTTGTTGG + Intronic
1049017058 8:139928141-139928163 TTAGAGCCAGACAGTTTTGGTGG - Intronic
1049234832 8:141507304-141507326 CTAGGGTCTGTCTGTGTTGTGGG + Intergenic
1052387500 9:27839047-27839069 GTAGACTCAGAATGTTTGGTAGG + Intergenic
1053268402 9:36732763-36732785 CTAGAGCTAGACTGCTTTGGAGG - Intergenic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1056856478 9:90134344-90134366 CTTAAGTCAGATTGTTTTCTTGG + Intergenic
1058215416 9:102227024-102227046 TTATAGTTAGCCTGTTTTGTTGG + Intergenic
1059008490 9:110430451-110430473 CTAGAAACAGACAGTTTTGGTGG + Intronic
1059232242 9:112731651-112731673 CTAGAATGTGTCTGTTTTGTGGG - Intergenic
1061494136 9:130962055-130962077 GTAGGGTCAGATTGTGTTGTAGG + Intergenic
1062707550 9:137953787-137953809 CTGGAGTCAGAGGGTGTTGTGGG + Intronic
1186923124 X:14303501-14303523 ATAGATTCAAACTGTTGTGTGGG - Intergenic
1192208047 X:69109137-69109159 GTAGGGTCAGACTGTCTTCTAGG + Intergenic
1193993063 X:88332796-88332818 CTAGATGAAGTCTGTTTTGTTGG + Intergenic
1194854843 X:98915782-98915804 CTGGATTCAGCCTGTTTTCTAGG + Intergenic
1196372878 X:114998704-114998726 CCAGAGTCAGACTGGCTTGTGGG - Intergenic
1198071565 X:133153495-133153517 CTTGAGTCAGATTCTCTTGTAGG + Intergenic
1198589310 X:138159221-138159243 CTACAGTCACAGTGTTTAGTGGG + Intergenic