ID: 1022835538

View in Genome Browser
Species Human (GRCh38)
Location 7:34110298-34110320
Sequence TGGGAGAAGCTGAGTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 907
Summary {0: 1, 1: 0, 2: 9, 3: 75, 4: 822}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022835538_1022835545 5 Left 1022835538 7:34110298-34110320 CCTTCCCCACTCAGCTTCTCCCA 0: 1
1: 0
2: 9
3: 75
4: 822
Right 1022835545 7:34110326-34110348 TCAGTGTCTGTATTTGTTGAAGG 0: 1
1: 2
2: 3
3: 26
4: 386
1022835538_1022835546 10 Left 1022835538 7:34110298-34110320 CCTTCCCCACTCAGCTTCTCCCA 0: 1
1: 0
2: 9
3: 75
4: 822
Right 1022835546 7:34110331-34110353 GTCTGTATTTGTTGAAGGTGAGG No data
1022835538_1022835550 25 Left 1022835538 7:34110298-34110320 CCTTCCCCACTCAGCTTCTCCCA 0: 1
1: 0
2: 9
3: 75
4: 822
Right 1022835550 7:34110346-34110368 AGGTGAGGGTACGGAACAGGAGG No data
1022835538_1022835551 26 Left 1022835538 7:34110298-34110320 CCTTCCCCACTCAGCTTCTCCCA 0: 1
1: 0
2: 9
3: 75
4: 822
Right 1022835551 7:34110347-34110369 GGTGAGGGTACGGAACAGGAGGG No data
1022835538_1022835549 22 Left 1022835538 7:34110298-34110320 CCTTCCCCACTCAGCTTCTCCCA 0: 1
1: 0
2: 9
3: 75
4: 822
Right 1022835549 7:34110343-34110365 TGAAGGTGAGGGTACGGAACAGG No data
1022835538_1022835547 11 Left 1022835538 7:34110298-34110320 CCTTCCCCACTCAGCTTCTCCCA 0: 1
1: 0
2: 9
3: 75
4: 822
Right 1022835547 7:34110332-34110354 TCTGTATTTGTTGAAGGTGAGGG No data
1022835538_1022835548 16 Left 1022835538 7:34110298-34110320 CCTTCCCCACTCAGCTTCTCCCA 0: 1
1: 0
2: 9
3: 75
4: 822
Right 1022835548 7:34110337-34110359 ATTTGTTGAAGGTGAGGGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022835538 Original CRISPR TGGGAGAAGCTGAGTGGGGA AGG (reversed) Intronic
900165323 1:1242177-1242199 TGGGCAGAGCTGAGTGGGGCCGG + Intergenic
900387617 1:2417728-2417750 TAGGGGAGGCTGTGTGGGGAAGG - Intergenic
900910908 1:5596499-5596521 CAGGAAAAGCTGTGTGGGGAGGG - Intergenic
901006357 1:6173546-6173568 AGAGAGAGGCTCAGTGGGGAGGG - Intronic
901055125 1:6445765-6445787 GGGGGGAAGCTGGGTGGGGGTGG - Exonic
901089539 1:6632250-6632272 AGGGAGAAGCTGGCTGTGGAGGG + Intronic
901511388 1:9719773-9719795 TGGGAGACCCTGCTTGGGGAAGG - Intronic
901689094 1:10961000-10961022 TGGGAGCAGGTGGGTGGGGGGGG - Intronic
901700582 1:11043152-11043174 TGTGGGAGGCAGAGTGGGGAGGG - Intronic
901850555 1:12012208-12012230 TGGGAGTAGCTCAGAGGGGAGGG + Exonic
902205621 1:14866179-14866201 GGAGAAGAGCTGAGTGGGGAGGG - Intronic
902479244 1:16702849-16702871 GGGGGGAAGCTGGGTGGGGGTGG + Intergenic
903230404 1:21918929-21918951 GGGGAGGAGCCCAGTGGGGAGGG - Intronic
903241673 1:21986781-21986803 TCCTAGAAGCTCAGTGGGGAAGG + Intronic
903245180 1:22009955-22009977 TCCTAGAAGCTCAGTGGGGAAGG + Intronic
903320358 1:22539304-22539326 GGGGGGAAGCTGGGTGGGAAAGG - Intergenic
903649491 1:24914197-24914219 TGGGAAAAGCAGAGTCGGGCAGG + Intronic
903658122 1:24961145-24961167 TCAGAGAAACTGAGAGGGGAGGG + Intronic
903895262 1:26598825-26598847 TAGGAGAAGTTGAGCTGGGAAGG + Intergenic
904010052 1:27384075-27384097 TAGGAGAAGCAGATGGGGGAAGG - Intergenic
904431617 1:30468168-30468190 TGGCAGAAGCAGAGCGTGGAAGG - Intergenic
904490987 1:30858928-30858950 TGTGTGAAGTTGGGTGGGGAAGG - Intergenic
904612257 1:31732225-31732247 TGGGCAAAGCTGGCTGGGGAGGG - Intronic
905263839 1:36737920-36737942 TGGGGGAAGCACAGGGGGGACGG - Intergenic
905886141 1:41493218-41493240 TGGGAGGCCCTGAGCGGGGAAGG + Intergenic
905913718 1:41671101-41671123 TAGGAGAGGCAGGGTGGGGAGGG - Intronic
906263012 1:44407333-44407355 TGGGGGGAGCAGAGTGGGCAGGG + Intronic
909034432 1:70581133-70581155 TGGTAGAAGCACAGTGGGCAGGG - Intergenic
909714475 1:78691368-78691390 TTGTAGAAGCTGAGTGATGAAGG + Intergenic
910203248 1:84721974-84721996 TGGGAAAATCGAAGTGGGGAGGG + Intergenic
910969721 1:92844085-92844107 TGGGAGAAGCAAAGTCGGCATGG - Exonic
911871200 1:103101519-103101541 TGTGAAAATCTGAGTGAGGAAGG + Intronic
912391651 1:109307118-109307140 TGGGCGTAGCTGAGTGGGGAGGG - Intergenic
912487328 1:110039525-110039547 TTTGAGAGGCTGAGTAGGGAAGG + Intronic
914899091 1:151702602-151702624 TGGGAGGAGGGGTGTGGGGAGGG - Exonic
915341449 1:155178892-155178914 TGGGAGCAGCGGGGTGGGAAGGG - Intronic
915945663 1:160149742-160149764 GGGGAGAATCTGAGTTTGGAGGG + Intergenic
915978918 1:160408224-160408246 TGGGTGGAGCTGGGTGGGGCAGG + Intronic
915989523 1:160499731-160499753 TAGGAGGAGCTGAATAGGGAAGG + Intronic
916575006 1:166059351-166059373 TGAAAGAATCTGGGTGGGGAGGG + Intronic
916950763 1:169778003-169778025 TGGGATGAGGGGAGTGGGGAGGG + Intronic
917051276 1:170926789-170926811 TGGGAGAACTTGAGAGGAGAGGG + Intergenic
917137236 1:171799520-171799542 TGGCTACAGCTGAGTGGGGATGG + Intronic
917738250 1:177939536-177939558 TGGCAGGAGCTGGGTGGAGAAGG + Intronic
917926753 1:179795514-179795536 TGGCAGAAGGTGAGTGAGCAAGG - Intronic
918289614 1:183094084-183094106 TGAGAGAAGCTGAGAGGAGGAGG - Intronic
918302835 1:183219613-183219635 TGGGAGGGGAGGAGTGGGGAGGG - Intronic
918705203 1:187651958-187651980 CAGTAGAAGCTGAGTGTGGAGGG + Intergenic
919036185 1:192312158-192312180 TGGGAATAGCTAACTGGGGAAGG + Intergenic
920201047 1:204259812-204259834 GGGAAGAAGAGGAGTGGGGAAGG + Intronic
920433847 1:205935842-205935864 TGGGAGAAGCAGAGGAGGGGAGG + Intronic
920565149 1:206967144-206967166 TGAGAGAAGCTGGGTGAGGGTGG + Intronic
920799395 1:209173240-209173262 TGGCAGAAGCTGAGCTGCGAGGG - Intergenic
920922416 1:210309250-210309272 GGGGAGAAGAGGAGAGGGGAGGG - Intergenic
920982980 1:210855685-210855707 AGGCAGCAGGTGAGTGGGGAGGG - Intronic
921066956 1:211630311-211630333 TGAGAGAGGCAGTGTGGGGAGGG - Intergenic
921851668 1:219938510-219938532 TGAGAGAAGCTAACTGGGGCAGG + Intronic
921951432 1:220934357-220934379 TGAGAGGAGCCCAGTGGGGAGGG - Intergenic
922169300 1:223141971-223141993 TGGGAGAAGTTCTGTGGGGCTGG - Intronic
922296799 1:224257052-224257074 TGGGAAAAGCTGGGTTGAGAGGG - Intronic
922896235 1:229102654-229102676 TGGAGGAAGGTGAGCGGGGAGGG - Intergenic
923093189 1:230754872-230754894 ATGGAGAAGCTGGGTGGGTAGGG + Intronic
923144388 1:231187690-231187712 TGGGAGAGGCGGGGTGGGAAAGG + Intronic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923372568 1:233328007-233328029 TGGGGGCAGCTGCGCGGGGAAGG - Exonic
923492189 1:234493771-234493793 GGGAAGAAGGAGAGTGGGGAAGG + Intergenic
923552747 1:234977202-234977224 AAGGAGAGGCTGAGTAGGGAGGG + Intergenic
923958361 1:239048703-239048725 TGGAGGAGGCTGGGTGGGGAAGG + Intergenic
924424126 1:243934260-243934282 GGGGAGAGGATGAGAGGGGAAGG - Intergenic
924428402 1:243974768-243974790 TAGGAGAAGAGGAGTGGGCAGGG - Intergenic
924944226 1:248835111-248835133 TGGAAGATGCTGAGTGGGGTGGG - Intergenic
1063202723 10:3800320-3800342 TGCCAGAAGCTGAGAAGGGATGG + Intergenic
1063631943 10:7742239-7742261 CGGGAGAGGGAGAGTGGGGATGG + Intronic
1065655954 10:27950045-27950067 ATGGAGAAGCTGTGTGGGGTAGG - Intronic
1067554704 10:47260605-47260627 GGGCAGAAGCTGTGTGGGGTGGG - Intergenic
1068516425 10:58030973-58030995 TGGGAGTAACTCAGTGGAGAGGG - Intergenic
1068833949 10:61531364-61531386 AGGGAGTAGGAGAGTGGGGATGG + Intergenic
1069615936 10:69806220-69806242 TGGGAGAAGGACACTGGGGAGGG + Intronic
1069720117 10:70544494-70544516 AGGCAGGAGCTGAGTGAGGAGGG + Intronic
1070273333 10:74979793-74979815 TGGGAGAAAGTAAGTGGGAATGG + Intronic
1070321296 10:75356712-75356734 TGGGAGAACCTGGGTGGGGCTGG - Intergenic
1070325395 10:75385396-75385418 TCGGTGAGGCTTAGTGGGGAGGG + Intergenic
1070417991 10:76208024-76208046 TGAGAGCAGCTGAGTATGGAAGG - Intronic
1070630190 10:78079291-78079313 TTGGAGGGGCTGAGTGGTGAAGG + Intergenic
1070815740 10:79321949-79321971 TGAGAGAAGCAGAGTAAGGAGGG - Intergenic
1070977265 10:80615053-80615075 AGGCAGCAGCTGAGTGGGAATGG + Intronic
1070988356 10:80708228-80708250 TGGGATAAGCGGAATGGGGAAGG + Intergenic
1071947865 10:90668342-90668364 AGAGAGAAGCTGAGTGGGCCTGG + Intergenic
1072537536 10:96374884-96374906 TGGGATAAGGTGAGCGGGGACGG + Intronic
1072862954 10:99025688-99025710 TGGGTATACCTGAGTGGGGAGGG + Intronic
1072920048 10:99569130-99569152 TGGGAGAGGAGGAGTGGGGCTGG + Intergenic
1073006766 10:100330567-100330589 TGGGAGGAGCTGAGACAGGAGGG + Intergenic
1073077109 10:100831001-100831023 TGGTAGAAGCTGGGCTGGGAAGG - Intergenic
1073124018 10:101138957-101138979 TGGAAGAAGCTGTGTGGTGGAGG + Intergenic
1073247605 10:102102614-102102636 TGTGGGAAGCTGAATGGGAATGG - Intergenic
1073535849 10:104275759-104275781 TGGGTGAAGGGGACTGGGGAGGG - Intronic
1073875155 10:107914461-107914483 TGCGAGTAGCAGAGTGGTGATGG - Intergenic
1074363792 10:112842282-112842304 TGGGGGAAGCAGGGTGGGGCAGG - Intergenic
1074580179 10:114711722-114711744 AGTGAGTAGCTGAGTGGAGAGGG + Intergenic
1074591284 10:114816215-114816237 TGGGAGAAACTTAGAGGGAAAGG - Intergenic
1074616982 10:115079359-115079381 TGGGAGAAGCAGGTTTGGGAGGG - Intergenic
1075080099 10:119377902-119377924 TGGGAAAAACTGATTGGGAAAGG + Intronic
1075277822 10:121110917-121110939 TGGGTGAAGCTGGGTGGGTTAGG + Intergenic
1075763999 10:124878565-124878587 TGGAAGAAGCCAAGTGGGAAGGG - Intergenic
1075838620 10:125477723-125477745 GGGGGGAAGTGGAGTGGGGATGG + Intergenic
1075857188 10:125639610-125639632 TGGGGGAAGCTGAGGGTGGGAGG + Intronic
1075860961 10:125675837-125675859 TGGGATAAAATTAGTGGGGAGGG - Intronic
1076241341 10:128910400-128910422 TGGGAGAAGTAGACAGGGGATGG - Intergenic
1076748289 10:132525542-132525564 GGGGAGGTGCTGAGAGGGGAGGG + Intergenic
1076785737 10:132749024-132749046 TGGGTGAAGCTGACGTGGGAGGG - Intronic
1076938864 10:133586892-133586914 TGGGAGACGGGGTGTGGGGAGGG - Intergenic
1077290023 11:1784812-1784834 TGGGAGAAGCGGGGTTGGGAAGG - Intergenic
1077606214 11:3614637-3614659 AGGGAGAAGCTGGGTGAGGTGGG - Intergenic
1078334052 11:10450482-10450504 TGGGAAAAGTTGTGCGGGGAGGG + Intronic
1080043589 11:27785029-27785051 TGGCTGAATCTGATTGGGGATGG + Intergenic
1080596067 11:33774947-33774969 GGGGACAAGCGGGGTGGGGAAGG - Intergenic
1080820270 11:35799211-35799233 TGGCAGAACCTGTGTGGGGATGG - Intronic
1081794573 11:45810746-45810768 GGGGAGAGGAGGAGTGGGGAAGG - Intronic
1082101516 11:48176801-48176823 TGGGAGCAGCTCAGGGGAGAAGG + Intergenic
1082182374 11:49135133-49135155 TGGCAGAAGCTGGGCTGGGATGG - Intergenic
1083232468 11:61332185-61332207 TGGAGGTAGCTGAGTGTGGATGG - Intronic
1083595343 11:63916270-63916292 TGGGGGGAGCGGAGTGGGGCGGG - Intronic
1083616416 11:64028687-64028709 TGGGAGGAGCTGCGGGAGGAGGG - Intronic
1083715794 11:64576205-64576227 TGGGAGGATTTGACTGGGGAGGG - Intergenic
1083896686 11:65623668-65623690 TGGGAAAAGTCGGGTGGGGAAGG - Intronic
1084021547 11:66420906-66420928 CGGGAGCCGCTGACTGGGGAGGG - Intergenic
1084179237 11:67438315-67438337 TGGCAGAAGCTGAGTGGGAAGGG + Exonic
1084268446 11:68016780-68016802 TGGCAGAAGCTCAGTGGTGGCGG - Intronic
1084598038 11:70128844-70128866 TGCGAGAAGCTGAGGTGGGCAGG + Intronic
1084693295 11:70739282-70739304 TGGGTGGAGATGAGTGGAGATGG - Intronic
1085051603 11:73382907-73382929 TGGGAGGAGCTGGGTGGGCCAGG + Intronic
1085731013 11:78998759-78998781 TGGCAGCAGGTAAGTGGGGAGGG + Intronic
1085759374 11:79228512-79228534 TCTGAGAAGGTGGGTGGGGATGG - Intronic
1085780462 11:79403636-79403658 TGGGAGAATGTGAGTGTCGAGGG - Intronic
1086998992 11:93393445-93393467 TGTGGGAAGCTGAGGTGGGAAGG - Intronic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087257435 11:95972176-95972198 TGAGAGAAGATGAGTGAGGGTGG + Intergenic
1087424004 11:97967064-97967086 TGGGAGAAGCTGTCTGTTGAGGG + Intergenic
1087497087 11:98905864-98905886 TGGGTGAAGGTGGGAGGGGATGG - Intergenic
1088797319 11:113274617-113274639 TGAGGGCAGCTGAGTGGGCAGGG - Intronic
1088945934 11:114512562-114512584 AGAGAGCAGCTGTGTGGGGAAGG + Intergenic
1089004013 11:115075577-115075599 GGGAAGAAGCTGAGTGGAGAGGG + Intergenic
1089011107 11:115132497-115132519 TTGGTGGAGCTGAGTTGGGAGGG - Intergenic
1089299944 11:117492584-117492606 GGGGAGAAGGGGAGTGGGGTGGG - Intronic
1089400148 11:118159817-118159839 TGGGAATAGATGAGTTGGGATGG - Intergenic
1089472811 11:118734444-118734466 ATGGAGATGCTGAGTGGGAAAGG + Intergenic
1089669123 11:120040226-120040248 TGAGAGAAGCTGATAGCGGAAGG - Intergenic
1089748491 11:120633719-120633741 AGGGAGAGGCTGGGAGGGGAAGG + Intronic
1090124950 11:124075710-124075732 CGGGGGAAGCTGAGTGGTGGGGG - Intergenic
1090374028 11:126276520-126276542 TGAGGTAAGCTGAGTGGGGTGGG + Exonic
1090816526 11:130301804-130301826 TGTGAGAGGCTGAGTTGGGCAGG + Intronic
1090832142 11:130427428-130427450 CTGGAGAAGATGAGTGGGGAGGG + Intronic
1090988589 11:131795767-131795789 TGGGAGCAGTTGACTGGGGTTGG + Intronic
1091095955 11:132822244-132822266 TGGGAGAGGGAGAGTGAGGAGGG - Intronic
1091230939 11:133987540-133987562 CGGGAGAGGCTGGGTGGGGGGGG + Intergenic
1091358829 11:134958345-134958367 TGGGCAAAGCTGAGTGTGGCTGG + Intergenic
1091407139 12:216097-216119 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407152 12:216192-216214 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407165 12:216287-216309 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407182 12:216382-216404 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407195 12:216477-216499 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407211 12:216572-216594 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091447457 12:552165-552187 TGAGAGACACTGAGTGGGGCAGG + Intronic
1091591408 12:1845070-1845092 AGGGAGAAGCAGGGTGGGGGTGG + Intronic
1091743308 12:2975267-2975289 TAGGAGAAACTGACTGGGGGCGG - Intronic
1091930851 12:4394174-4394196 TGGGTGAAGCTGGTGGGGGAAGG - Intergenic
1092051825 12:5476366-5476388 TAGGAGCAGCTGTGAGGGGAGGG + Intronic
1092906771 12:13107460-13107482 TATGAGAAGCTGAGGGAGGATGG + Intronic
1094220200 12:27984807-27984829 TGGGAGAAGCTGAAAGGACATGG + Intergenic
1094686372 12:32720143-32720165 TGGGAGAATGACAGTGGGGATGG - Intronic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1094769843 12:33642626-33642648 TTGGATAAGCTGAGTGAAGATGG + Intergenic
1095201967 12:39395352-39395374 TGGGATGAGCGGGGTGGGGATGG - Intronic
1096192251 12:49627545-49627567 TGAGAGAAGGTGAGTAGGGCTGG + Intronic
1096229821 12:49890637-49890659 GGACAGACGCTGAGTGGGGATGG - Intronic
1096623634 12:52879792-52879814 TGGGGGGAGCTGAGGGCGGAGGG - Intergenic
1096833916 12:54336105-54336127 TGGGAGAATATGTTTGGGGAAGG - Intronic
1097327085 12:58289104-58289126 CGGGAGAGGCAGACTGGGGAGGG + Intergenic
1098450208 12:70610406-70610428 GGGGAGACGCTGGGTGTGGAGGG - Intronic
1100431966 12:94539002-94539024 TGTGAAAAGCTGAGTGTGGGAGG - Intergenic
1100497042 12:95135130-95135152 TGGGAGCTGCTGAGTAGGGTGGG - Intronic
1100592655 12:96043944-96043966 TGGGAGAAGCAGACTGGAGTGGG + Intergenic
1100651775 12:96597906-96597928 TGGGAGAGGCTGATTAGGGTGGG + Intronic
1100824102 12:98458553-98458575 TGGGGGGAGCGGAGAGGGGAGGG + Intergenic
1101072225 12:101087735-101087757 TGGGAGGAGCTGATTCTGGAGGG - Intronic
1101256513 12:102982876-102982898 TTAGAGAAGTGGAGTGGGGAAGG + Intergenic
1101433942 12:104649110-104649132 TGGGGGAAGCAGAGTAGAGAAGG + Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102517298 12:113458408-113458430 TGAGAAAGGCTGGGTGGGGAAGG - Intergenic
1102760608 12:115381600-115381622 GGGGAGTAGATGAATGGGGAGGG - Intergenic
1103229690 12:119318768-119318790 TGGGTGGAGGTGGGTGGGGAGGG + Intergenic
1103550573 12:121734194-121734216 TGGGAAAACTTGAGTGGCGAGGG + Intronic
1104038416 12:125114327-125114349 TGGGAGAAGCAGACTTTGGAGGG - Intronic
1104959481 12:132481587-132481609 GGGGAGACGGTGTGTGGGGACGG - Intergenic
1105540888 13:21315708-21315730 TACCAGAGGCTGAGTGGGGAGGG - Intergenic
1105652053 13:22389728-22389750 TAGAAGAAGCTGAGTTTGGAAGG - Intergenic
1105774659 13:23646363-23646385 TGGAAGTAGCTTAGTGGTGATGG - Intronic
1106525295 13:30535138-30535160 AGAGAAAGGCTGAGTGGGGAAGG - Intronic
1107222102 13:37995161-37995183 AAGGAAAAGCTGAGTGGAGAAGG - Intergenic
1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG + Intergenic
1107848813 13:44549656-44549678 TTGGAGAGGCTGAGGTGGGAGGG + Intronic
1108117083 13:47140531-47140553 TGGATGAAGCTTAGAGGGGAAGG + Intergenic
1108289306 13:48942364-48942386 AGGGAGTATCTGAGTGAGGAGGG + Intergenic
1108556836 13:51601720-51601742 AGGAAGAGGCAGAGTGGGGAAGG + Intronic
1108717062 13:53091566-53091588 GAGGAGAAGCAAAGTGGGGAGGG + Intergenic
1109222889 13:59658623-59658645 TGAGAGAGGCTGAGTGATGAGGG + Intergenic
1109297084 13:60547334-60547356 TGAGAGAAGGGGAGTGGGCAAGG + Intronic
1109446889 13:62451177-62451199 TGGGACAATGTGTGTGGGGAAGG + Intergenic
1112404964 13:99111294-99111316 TAGGAAAAGAGGAGTGGGGAAGG - Intergenic
1113666142 13:112143223-112143245 TGGGTGCAGATGAGTGAGGAGGG - Intergenic
1114665067 14:24372791-24372813 TGGGATGAGCTGAGTGGGGGTGG - Intronic
1115783153 14:36793499-36793521 TGGGAGGAGCAGAGGGGAGAAGG - Intronic
1115877717 14:37879408-37879430 TAGGAGAAGCAGAGTTGGGCTGG + Intronic
1116216210 14:42020540-42020562 TGGGAGTGGCGGAGTGGGGAGGG + Intergenic
1116683812 14:48011824-48011846 TTGTAGACTCTGAGTGGGGAAGG + Intergenic
1117294989 14:54370932-54370954 TGGGAGGAGCTGACTGGGGGAGG - Intergenic
1118946150 14:70389296-70389318 TGGGAGAAGGAAAGTGTGGAAGG - Intronic
1119630212 14:76224229-76224251 TGGGAAAAGGGGAATGGGGAAGG + Intronic
1119770296 14:77216498-77216520 TGGAACATGCTAAGTGGGGACGG - Intronic
1119891873 14:78189004-78189026 TGGGAGGAGCAGATTGGGGCAGG - Intergenic
1119931483 14:78551767-78551789 GGGGGGAAGTAGAGTGGGGAAGG - Intronic
1120093222 14:80358270-80358292 TGGCAGAAGGTGCGTGAGGAAGG + Intronic
1120197614 14:81502740-81502762 TTTGAGAAGCTGACTGAGGAAGG - Exonic
1120571564 14:86124163-86124185 TTGTAGAAGCTGAGTGAGAAAGG + Intergenic
1120743989 14:88137472-88137494 TTGGAGAGCCTGAGTGTGGAAGG - Intergenic
1120993393 14:90397645-90397667 GCGGAGAAGCGGGGTGGGGAGGG - Intronic
1121108645 14:91297049-91297071 CGGGAGAGGCACAGTGGGGACGG - Intronic
1121307828 14:92917986-92918008 TGGGAGAAGATGGGTGGGGAGGG - Intergenic
1121675956 14:95753103-95753125 TGAGAGGTGCTGGGTGGGGATGG + Intergenic
1121836026 14:97093138-97093160 GGAGAGAGGCTGGGTGGGGATGG + Intergenic
1122863575 14:104593504-104593526 TGGAAGGAGGTGCGTGGGGACGG + Exonic
1122869217 14:104627837-104627859 AGGAAGAGACTGAGTGGGGAGGG - Intergenic
1123675474 15:22706968-22706990 TGGGGGAAGCTGTGTGTGTATGG + Intergenic
1124067854 15:26362966-26362988 TGGCATCAGTTGAGTGGGGAGGG + Intergenic
1124327467 15:28779914-28779936 TGGGGGAAGCTGTGTGTGTAAGG + Intergenic
1124347049 15:28930057-28930079 TGGAAGGAGCTGAGTTGGGGAGG + Intronic
1124769180 15:32515772-32515794 TGGGGGAAGCTGTGTGTGTATGG - Intergenic
1125599160 15:40906286-40906308 GGGGAGCAGCTGCGTGGGCAGGG + Intergenic
1125769348 15:42154538-42154560 GGGAAGGAGCAGAGTGGGGAGGG + Intronic
1126326255 15:47480647-47480669 TGGCAGAAGCAGGGTGTGGAGGG - Intronic
1128052218 15:64674534-64674556 TGGGGGTAGCTGAGCGGGCAGGG - Exonic
1128992884 15:72275157-72275179 TGGGAGAGGCTGACATGGGAAGG - Intronic
1129270382 15:74416423-74416445 TGGGAGCAGCTGTGTGTGCATGG - Intronic
1129880119 15:79000950-79000972 TGGAGAAAGCTGTGTGGGGAGGG + Intronic
1130895608 15:88168346-88168368 GGGGAGAAGAAGAGTGGAGATGG + Intronic
1130934018 15:88453755-88453777 TGGAAGAAGCTCTGTGGGGCTGG - Intergenic
1130990116 15:88871122-88871144 TGGGAGAGGGTGAGGGGGGAGGG + Intronic
1131147647 15:90024531-90024553 TGGCAGTAGATGTGTGGGGAAGG + Intronic
1131284738 15:91047920-91047942 GGGGAGAAGCGGAGGGGGGAAGG - Intergenic
1131342493 15:91615600-91615622 TGGGAGAAGCTGATTTGGGAAGG + Intergenic
1131701639 15:94943010-94943032 TGGGGGGAGGTGAGAGGGGAAGG + Intergenic
1131904955 15:97133177-97133199 TTTGAGAAGCTGAGGTGGGAGGG - Intergenic
1131988740 15:98071398-98071420 TGGGAGAAGAAGAGTGGGAGTGG - Intergenic
1132268688 15:100503678-100503700 CGGGTGAAGCAAAGTGGGGAGGG - Intronic
1132354242 15:101159484-101159506 TGTGAAAAGGTGAGTGGCGATGG - Intergenic
1133634224 16:7650850-7650872 GGGGAGAAAATGAGTGGGAATGG - Intronic
1133760729 16:8796537-8796559 GGGGAAAAGCTGTGTGGGAAAGG - Exonic
1133799714 16:9075140-9075162 TGCAAGAAGCTGCGTGGGGTGGG + Intergenic
1134401529 16:13914501-13914523 GGGGAGAGGCTGAAGGGGGAGGG - Intergenic
1135363785 16:21835939-21835961 AGGGTGGAGCTGAGTGTGGAAGG + Intronic
1136064203 16:27747748-27747770 TGGGAGAGGCTGGGAGGGGTGGG + Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1136189483 16:28607107-28607129 TGGGACAGGCTGTGTGGTGATGG - Intronic
1136297284 16:29310913-29310935 TGGGAGAGGCTGCCTGTGGAGGG + Intergenic
1136566940 16:31076337-31076359 TCGGAGCAGCTGAGTGAGGGGGG - Exonic
1136573403 16:31109649-31109671 TGGGAGAAAATGAGAAGGGAAGG - Intronic
1136640079 16:31556903-31556925 TGGGAGACTCTGAGAGGGAAAGG + Intergenic
1137565790 16:49531769-49531791 TGGGAGCAGGTGAGTGGTGATGG + Intronic
1138255657 16:55556847-55556869 TAGGAGGATTTGAGTGGGGAAGG + Intronic
1138530229 16:57630775-57630797 TGGGAGAAGGTGGGAGGGGAAGG + Intronic
1138574763 16:57900611-57900633 AGGGTGAAGCTGAGCAGGGAGGG + Intronic
1138918163 16:61493696-61493718 TGAGAGAAGCAGATTGGAGAGGG + Intergenic
1139093015 16:63671879-63671901 TGGGAGAGGGGGAGTGGGGAAGG - Intergenic
1139379172 16:66519816-66519838 TGGGAGGCTCTCAGTGGGGAGGG + Intronic
1140850548 16:78931225-78931247 CTGGAGATGCTGTGTGGGGAGGG + Intronic
1141238194 16:82240205-82240227 TGTGAAAAGCTGATTGGGGGTGG + Intergenic
1141464881 16:84198760-84198782 TGGGAGAATCTGAGGGAGGTGGG + Intergenic
1141662302 16:85448007-85448029 AGGGAGAAGCAGAGCTGGGAAGG + Intergenic
1142058845 16:88017015-88017037 TGGGAGAGGCTGCTTGTGGAGGG + Intronic
1142200690 16:88759877-88759899 AGGGGGAAGCTGTGTGGGGAGGG + Intronic
1142287788 16:89178469-89178491 TGGGAGAAGAAGAGTGAGGCTGG + Intronic
1142291456 16:89195293-89195315 GGGCAGAACCTGAGTGTGGATGG + Exonic
1142348840 16:89570745-89570767 CGGGAGGAGGTGAGCGGGGACGG + Intergenic
1142348869 16:89570847-89570869 CGGGAGCAGGTGAGCGGGGACGG + Intergenic
1142348888 16:89570908-89570930 CGGGAGGAGGTGAGCGGGGACGG + Intergenic
1142348895 16:89570928-89570950 CGGGAGGAGGTGAGCGGGGACGG + Intergenic
1142348902 16:89570948-89570970 CGGGAGGAGGTGAGCGGGGACGG + Intergenic
1142348923 16:89571010-89571032 CGGGAGGAGGTGAGCGGGGACGG + Intergenic
1142348944 16:89571072-89571094 CGGGAGGAGGTGAGCGGGGACGG + Intergenic
1142348951 16:89571092-89571114 CGGGAGGAGGTGAGCGGGGACGG + Intergenic
1142349004 16:89571255-89571277 CGGGAGGAGGTGAGCGGGGACGG + Intergenic
1142349011 16:89571275-89571297 CGGGAGGAGGTGAGCGGGGACGG + Intergenic
1142643080 17:1295790-1295812 AGGGACCAGATGAGTGGGGATGG + Intronic
1142685984 17:1577229-1577251 TGGGCACAGCTGAGTGGGGTGGG - Intronic
1142880290 17:2878412-2878434 TGGGTGAGGCTGAGTGGGAGAGG + Intronic
1142978009 17:3656641-3656663 TGGGAGAAGCTGGGTGGTGAGGG - Intronic
1143111272 17:4554354-4554376 TGGGAGAAGTTGAAGGGGGAAGG - Intronic
1143563491 17:7708519-7708541 TGGGACAAAGTGAGTGGGGCTGG + Exonic
1143591008 17:7885680-7885702 TTGGACAGGCAGAGTGGGGACGG + Intronic
1143652347 17:8271297-8271319 TGGGAGTGGGTGAGTGGGAATGG - Intergenic
1143731322 17:8884542-8884564 TGAGAGAAGCAGAGAAGGGAAGG - Intronic
1143755531 17:9064533-9064555 AGGGAGGAACTGATTGGGGATGG - Intronic
1143757060 17:9074912-9074934 TGGGAAACGCAGAGTGAGGACGG - Intronic
1143924188 17:10355315-10355337 GAGGAGGAGCTGAGTAGGGAGGG + Intronic
1144098607 17:11924012-11924034 GGGGAGAAGCTAAGAGTGGATGG - Intronic
1144206695 17:12984611-12984633 GGGGACAGGCTGACTGGGGACGG - Exonic
1144689110 17:17248093-17248115 TGTGAGAAGCAGAGTCGGGGTGG - Intronic
1144743113 17:17595460-17595482 TGGGAGGAGATGGGTGGGCAGGG + Intergenic
1145221930 17:21096604-21096626 TAGGATAAGTTGGGTGGGGAAGG + Intergenic
1145866723 17:28246592-28246614 TGGGAGAGGCTGACAGGAGACGG + Intergenic
1146006220 17:29162375-29162397 TGGGAGACGGTGTGTGGGAAGGG - Intronic
1146311819 17:31775084-31775106 TGGGAAAATCTGCCTGGGGATGG - Intergenic
1146552046 17:33789094-33789116 TGGCAGAAGCTGAACGGGGCAGG - Intronic
1147745352 17:42691334-42691356 TGGGAGGAGCTGAGTGGCTGGGG + Intronic
1148052758 17:44777186-44777208 TACGAGAAGCTGAATGTGGAGGG + Exonic
1148153908 17:45411929-45411951 AGGGAGGAGCTGGGTGGAGAGGG + Intronic
1148216807 17:45837756-45837778 TGAGAGAATCTGAGGGCGGAGGG + Intergenic
1148358692 17:46994414-46994436 TGGGAGTTGAAGAGTGGGGAGGG + Intronic
1148466201 17:47866672-47866694 TGGGGGAAGATGGGTGGGCAAGG - Intergenic
1148862220 17:50610321-50610343 TGAGAGGAGCAGAGAGGGGAAGG + Intronic
1148867826 17:50638234-50638256 TGGGAGCACCTGGGTGGTGAAGG + Intronic
1148905870 17:50911798-50911820 AGGCAGAAGCTCGGTGGGGAGGG + Intergenic
1149786421 17:59439391-59439413 TTTGAGAAGCTGAGGTGGGAGGG - Intergenic
1150709014 17:67514109-67514131 AGGGAGAGACTGTGTGGGGAGGG + Intronic
1150816568 17:68396682-68396704 TGGGGGAGGCTGGGTGGGAAGGG - Intronic
1150835090 17:68556772-68556794 TGGGAAAAGCTGATTGGGAGAGG + Intronic
1151246961 17:72802631-72802653 TGGGTTAATTTGAGTGGGGAAGG + Intronic
1151282795 17:73089160-73089182 TGGTGGAGGCTGAGTGCGGATGG - Intronic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1151479510 17:74361942-74361964 TGGAGGAGGCTGAGTGGGGGAGG - Exonic
1151724377 17:75875939-75875961 TGGGAGCAGCTGAGGGGGCCGGG - Exonic
1151768584 17:76145167-76145189 AGGCAGCAGCTGAGTGAGGATGG + Exonic
1151780532 17:76242044-76242066 TGGGAGAAGCTGCCGGGGCAGGG - Intergenic
1151947195 17:77326129-77326151 TGGGTGAGGTTGGGTGGGGAGGG - Intronic
1151948222 17:77330907-77330929 AGGGACAAGCTGTGTGGGGCTGG - Intronic
1152209976 17:78997908-78997930 CGTGGGAAGCTGAGTGAGGAAGG + Exonic
1152619504 17:81355235-81355257 AGAGAGAAGCTTTGTGGGGATGG - Intergenic
1152850290 17:82629952-82629974 TGGGAGGAGGTGAGGAGGGAAGG - Intronic
1153773536 18:8433796-8433818 TGGGGGGCTCTGAGTGGGGAAGG + Intergenic
1154303028 18:13211359-13211381 TGGGGGAGGAGGAGTGGGGAGGG + Intergenic
1154496138 18:14962894-14962916 TGGGCAAAGCTGAGTGTGGCTGG - Intergenic
1155166485 18:23236328-23236350 TGGGGGGAGCTGAGTGGTCAGGG - Intronic
1155288976 18:24321712-24321734 TGGGAAAAGCTGGGTTGAGAGGG + Intronic
1156120526 18:33837167-33837189 TTGGAGATATTGAGTGGGGATGG - Intergenic
1156315535 18:35965749-35965771 TGAGAGAAGTGGAGTGGTGATGG + Intergenic
1156367448 18:36442140-36442162 TGGGAGAAGGGGAGCAGGGAGGG - Intronic
1156460554 18:37319224-37319246 TGGACGAGGCTGAGTGAGGATGG + Intronic
1156609659 18:38711469-38711491 TGGGACAAGGTGAGTGGGGGAGG + Intergenic
1156651575 18:39232989-39233011 TGGGAGAGGTTGAGTGGGGTGGG - Intergenic
1157604941 18:48920537-48920559 GGGGAGAGGCTGAGGGGAGAGGG + Exonic
1157716879 18:49894055-49894077 TGGGAATGGCAGAGTGGGGATGG + Intronic
1159620980 18:70638033-70638055 TGGGAGCAGGAAAGTGGGGATGG - Intronic
1159718184 18:71851118-71851140 TGGGTGAAGCTGACTGAGAAAGG - Intergenic
1159946873 18:74450547-74450569 TGTGAAAAGCAGAGTGAGGAGGG + Intronic
1160011389 18:75109284-75109306 TGGGAGGAGCTGGCTGGGGTCGG - Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1160618016 18:80148486-80148508 TGGGAGAAGCTGAGCTGCGCGGG + Intronic
1160993799 19:1872709-1872731 TGGGAGACGCCGAGTGCCGAGGG + Intergenic
1161255281 19:3305373-3305395 TCGGAGATGCTGGGTTGGGATGG + Intergenic
1162755402 19:12855502-12855524 TGGAACCAGCTGAGTGGGGGTGG + Intronic
1162869693 19:13576138-13576160 TGGGACAAGGTGAGTGAGGTGGG - Intronic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163462303 19:17446486-17446508 TGGTGGGAGCTGAGTGAGGATGG - Intronic
1163491623 19:17620243-17620265 TGGGTGAGGCTAGGTGGGGAGGG + Intronic
1163503025 19:17687439-17687461 TGGGAGAACCGGAGGGGGCAGGG + Intronic
1163529280 19:17840345-17840367 TGGGGGAAGGTGAGAGGGAATGG + Intronic
1163622480 19:18369210-18369232 TGTCACAAGCTGAGTGGGGGGGG + Exonic
1163668520 19:18614071-18614093 TGGGAGCGGGTGACTGGGGACGG - Intronic
1164463833 19:28470823-28470845 TTTGGGAAGCTGAGTGGGGAGGG + Intergenic
1164537991 19:29100658-29100680 AGGGAGAAGCTGAGAGAAGATGG - Intergenic
1164757696 19:30702643-30702665 CAGGGGAAGCTCAGTGGGGAGGG - Intronic
1164994373 19:32708884-32708906 TGGGAGATGCAGAGAGGGTAAGG - Intronic
1165788702 19:38477891-38477913 TGGGAGGTGCAGGGTGGGGAGGG + Intronic
1165878291 19:39025093-39025115 TGGGAGGAGAAGAGAGGGGAGGG + Exonic
1165963267 19:39553051-39553073 TCAGAGATTCTGAGTGGGGAGGG + Intergenic
1166233039 19:41436805-41436827 AGGGAGCAGAGGAGTGGGGATGG + Intronic
1166317671 19:41998133-41998155 TGAGAGAAGGTCAGTGGAGAGGG + Intergenic
1166631354 19:44410457-44410479 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1166834808 19:45660807-45660829 TGGGAGGGGCTGAGTTGGGATGG + Intergenic
1166850295 19:45756855-45756877 TGTGAGAAGCTCAGAGGGGCTGG - Intronic
1167419341 19:49394095-49394117 TGGGAGGAGCTGAGAGTGAAGGG - Intronic
1167724424 19:51200809-51200831 GGGGAGGAGCTGAGTAGGGAAGG - Intergenic
1168318084 19:55492919-55492941 TGGGAGAGGCTGAGGCGGGGAGG + Intronic
1168454579 19:56496453-56496475 TTGGAGAAACTGAAAGGGGAAGG + Intergenic
1168509312 19:56961678-56961700 GGGGAGAAGCGGAGAGGAGAGGG - Intergenic
1168599860 19:57708899-57708921 TGGGGGAAGGTGTGTGAGGACGG + Intronic
1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1202649372 1_KI270706v1_random:166431-166453 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1202713283 1_KI270714v1_random:28755-28777 GGGGGGAAGCTGGGTGGGGGTGG + Intergenic
924995621 2:357991-358013 AGGAAGCAGCTCAGTGGGGATGG - Intergenic
925694652 2:6563252-6563274 TGGGAAAAGCAGAGAGGGAAAGG - Intergenic
926071109 2:9892478-9892500 TGGGTGAAGCTGAGGAGGGAGGG - Intronic
926688131 2:15714301-15714323 TGGGTGAGGGTGAGTGGGAAGGG + Intronic
926707094 2:15844616-15844638 TGGCCGAAGCTGGGTGGGGTGGG - Intergenic
926742786 2:16126152-16126174 GGGCAGAAGCTGCGTGGAGAGGG - Intergenic
926802573 2:16672078-16672100 TGGGAGCAGCACAGAGGGGATGG + Intergenic
927200629 2:20575928-20575950 TGGGGGAAGGGGACTGGGGAGGG + Intronic
927886703 2:26723272-26723294 AGGGAGATGCGGGGTGGGGATGG - Intronic
928106208 2:28472041-28472063 TGGGGGCAGCTGCCTGGGGAGGG - Intronic
928176191 2:29035794-29035816 TGGAAGTGGCTGAGTGGGCAAGG + Intronic
929210326 2:39349740-39349762 TGGGAAAAGTTGAGAGGGGGAGG + Intronic
930001858 2:46866958-46866980 TGGGTGACTCTGTGTGGGGATGG + Intergenic
930136169 2:47905847-47905869 GGGGAGACGCTGAGGGCGGAGGG + Intergenic
930741254 2:54835035-54835057 AGGGAGAAGCAGCGAGGGGAAGG - Intronic
930913436 2:56659109-56659131 TGGGATAGGGGGAGTGGGGAGGG + Intergenic
931454575 2:62398561-62398583 TGGGGAAGGATGAGTGGGGAAGG - Intergenic
931651439 2:64472368-64472390 TGTGAGAAGCTGAGGTGAGATGG + Intergenic
931786034 2:65620168-65620190 TGGGAGGAGGTGAGTGTGGCAGG + Intergenic
931796112 2:65711720-65711742 TTGGAGAAGCTGATTGGGTTGGG + Intergenic
932196574 2:69788945-69788967 TGGGACAAACTGGATGGGGAGGG + Intronic
932311313 2:70744600-70744622 TGGCTGAAGCTGAGTGGCAAAGG + Intronic
932426129 2:71636552-71636574 TGGGAGGAGCAGACTGGGCAGGG + Intronic
932604828 2:73157960-73157982 TGGGACAAGCTGAGTGTGTGGGG + Intergenic
933759620 2:85664767-85664789 TGGGAAAGGCTGAGGGGGCAGGG + Intronic
933759779 2:85665504-85665526 TGGGAGAGGCAGAGCCGGGAAGG - Intronic
934061545 2:88298711-88298733 GGGGAGAAGGTGAGGGGAGAGGG + Intergenic
934761509 2:96859438-96859460 GGGGAGAAGCGGAGTGGTGGGGG - Intergenic
934812344 2:97291256-97291278 GGGAAGAAGGTGGGTGGGGAGGG - Intergenic
934825350 2:97416667-97416689 GGGAAGAAGGTGGGTGGGGAGGG + Intergenic
935442797 2:103122150-103122172 TGGGACAAGCTGTGAGGAGAAGG - Intergenic
935977533 2:108593621-108593643 TGGGAAAGGTTGGGTGGGGAAGG + Intronic
935986168 2:108675316-108675338 TGGGGGAAGAGGAGGGGGGAAGG + Intronic
936138609 2:109918931-109918953 TGGGGGAAGAGGAGGGGGGAAGG + Intergenic
936206087 2:110452554-110452576 TGGGGGAAGAGGAGGGGGGAAGG - Intronic
936629375 2:114184929-114184951 TGGGGGAAGCTGAGTGAGAAGGG + Intergenic
936893998 2:117406077-117406099 TGGGTGAAGCTAAGTGAGCATGG + Intergenic
937036497 2:118786659-118786681 AGAGAGAAGCCCAGTGGGGACGG - Intergenic
938177050 2:129143488-129143510 AGGGACAAGCTGAGTTGGAAAGG - Intergenic
938307159 2:130264068-130264090 TGGGAAGGGCTGAGTGTGGATGG + Intergenic
938307599 2:130265880-130265902 TGGGGAATGCTGGGTGGGGAAGG - Intergenic
938447733 2:131390962-131390984 TGGGGAATGCTGGGTGGGGAAGG + Intergenic
938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
938573768 2:132585458-132585480 CGGGAGAAGCGGGGAGGGGACGG - Intronic
938775619 2:134538838-134538860 TGGGAGGGGCTGGGTGGTGAAGG + Intronic
939267057 2:139887835-139887857 TGGGAGAAGTTGAGTGTGATAGG + Intergenic
939617828 2:144380229-144380251 TGGGACATGTTGATTGGGGAAGG + Intergenic
940420734 2:153477573-153477595 TGGGAGAAGGGGTGGGGGGAGGG - Exonic
940500688 2:154489898-154489920 TGGGGGAAGGTGGGCGGGGAAGG - Intergenic
941007051 2:160258607-160258629 TGTGGGAAGCTGATTGGGGCTGG + Intronic
941284869 2:163598231-163598253 TGGGGGAGGCAGAGTGAGGAAGG - Intronic
941870590 2:170381011-170381033 GTTGAGAGGCTGAGTGGGGAGGG + Intronic
942045176 2:172095702-172095724 TGGCAGATCCTGGGTGGGGAGGG + Intergenic
942382645 2:175408131-175408153 TGGGAAAAGTGGAGTGGGGGTGG - Intergenic
942450179 2:176104367-176104389 TCGTAAAAGCTGACTGGGGAAGG - Intronic
942661259 2:178267431-178267453 TGGGAGAAGTGAAGTGGGGAAGG - Intronic
942891758 2:180998444-180998466 TGGGATAAGGAGAGTGGGGAAGG + Intronic
943055489 2:182972882-182972904 TATAAGAAGCTGAGTAGGGAAGG + Intronic
943169465 2:184378579-184378601 TGGAAGAAACTAAGTGTGGAGGG + Intergenic
943537600 2:189171900-189171922 TGGATGAAGCTGAGAGGGAAAGG + Intronic
943703643 2:191013012-191013034 CGGGGGAAGGTGGGTGGGGAGGG + Intronic
943746534 2:191468112-191468134 TGGGAAAAGCACAGTGGGGGAGG - Intergenic
943952018 2:194142483-194142505 TGGAAGAGGCTGTGTGGTGATGG - Intergenic
944126404 2:196298638-196298660 TGGGGTAGGCGGAGTGGGGAGGG - Intronic
945980637 2:216307653-216307675 TGGGAGAAGCCAAGCGGGCAGGG - Intronic
946145764 2:217729732-217729754 TGGGCGAAGCTGAGCTGGAAAGG + Intronic
946954842 2:224918025-224918047 TTGGAGAAGATGGGTAGGGAGGG + Intronic
947002484 2:225472949-225472971 TGGGGTAAGCGGAGTGGGGAAGG - Intronic
947188272 2:227473087-227473109 GGGGAGAAGCTGGGGTGGGAGGG + Intronic
947549975 2:231038529-231038551 GGAGAGAAGAGGAGTGGGGAAGG + Intronic
947624807 2:231612867-231612889 CGGGAGATGCTGAGTGGAGGTGG + Intergenic
947694431 2:232172300-232172322 TGTGAGAAGCTGGGGGGAGAGGG - Intronic
947806261 2:232970430-232970452 TGGAGGAAGCAGAGTGGGAAGGG + Intronic
947889909 2:233608245-233608267 TGGCAGAAGGTGAGGGTGGAGGG + Intergenic
947894579 2:233657402-233657424 TGGCAGAAGGTGAATGTGGAAGG + Intronic
947895338 2:233666100-233666122 TGGCAGAAGGTGAGGGTGGAGGG + Intronic
948139721 2:235663354-235663376 TGGGAGCAGCAGCGTGGGGTTGG + Intronic
948236119 2:236391962-236391984 AAGGACAAGGTGAGTGGGGAAGG - Exonic
948249947 2:236519209-236519231 TGGGGGAAGCTGACAGGCGAGGG - Intergenic
948264172 2:236625364-236625386 TGTAAGGAGCTGAGTGTGGAGGG + Intergenic
948468016 2:238161416-238161438 GGGGAGAAGCTGTGAGGGGTTGG + Intronic
948570374 2:238913793-238913815 TGGGTAAGGCAGAGTGGGGATGG + Intergenic
948602245 2:239113970-239113992 TGGGGGAAGCTCGGTGGAGAAGG + Intronic
948694317 2:239725544-239725566 AGGGAGAAGGTGAGTGAGGGAGG + Intergenic
1169084960 20:2820904-2820926 TAGGAGAGGCCGAGTGGGGCTGG + Intergenic
1169297402 20:4412009-4412031 AGCTGGAAGCTGAGTGGGGAGGG + Intergenic
1169889192 20:10434255-10434277 CCGGAGAAGCGGAGTGGGGGCGG - Intergenic
1170748796 20:19125094-19125116 TGGGAGAGGTAGAGTGGCGAGGG + Intergenic
1171124648 20:22591084-22591106 TCAGAGCAGCTGAGAGGGGAAGG - Intergenic
1171127197 20:22612927-22612949 TGGGACAATCTGTGTGGTGATGG - Intergenic
1171768390 20:29302153-29302175 AGGGATAAGCTGGGGGGGGAAGG + Intergenic
1172204788 20:33155536-33155558 TGGGAGAAGCTGAGAGGAAAGGG - Intergenic
1172605982 20:36214365-36214387 TGGGAGTGCCTCAGTGGGGAGGG + Exonic
1173331371 20:42078722-42078744 TGGGAGAAGCAGTCTGGGGGAGG - Exonic
1173542836 20:43867525-43867547 TGGCAGAGGCTGTGTGTGGATGG - Intergenic
1173804846 20:45917797-45917819 AGGGACAGGCTGAGTGGGGAAGG - Intergenic
1174311601 20:49660029-49660051 TGGGAGAGGGTGTCTGGGGAAGG - Intronic
1174505471 20:51014978-51015000 TGGGAGAAGAGGAGAGGGGCAGG + Intronic
1174970642 20:55271436-55271458 TGGGAGAAGCAGACCGGGGAAGG - Intergenic
1175141002 20:56860183-56860205 GGGGAGGGGCTGAGAGGGGAGGG - Intergenic
1175191838 20:57216714-57216736 TAGGGGAAGGTGTGTGGGGAGGG + Intronic
1175278629 20:57788164-57788186 TGGGACAAGATGTGTGTGGATGG + Intergenic
1175491522 20:59383838-59383860 GAGGAGGAGGTGAGTGGGGAGGG + Intergenic
1175491912 20:59385126-59385148 GGGGAGGAGCTGAGTGGGGAAGG + Intergenic
1175871864 20:62212964-62212986 TGGGGGAAGGAGAGCGGGGATGG + Intergenic
1175871893 20:62213031-62213053 TGGGGGAAGGAGAGCGGGGATGG + Intergenic
1175871903 20:62213055-62213077 TGGGGGAAGGAGAGCGGGGATGG + Intergenic
1175871922 20:62213101-62213123 TGGGGGAAGGAGAGCGGGGATGG + Intergenic
1175871941 20:62213147-62213169 TGGGGGAAGGAGAGCGGGGATGG + Intergenic
1175871962 20:62213195-62213217 TGGGGGAAGGAGAGCGGGGATGG + Intergenic
1175872023 20:62213343-62213365 GGGGGGAAGGAGAGTGGGGATGG + Intergenic
1175872033 20:62213367-62213389 TGGGGGAAGGAGAGTGGGGATGG + Intergenic
1175872043 20:62213391-62213413 TGGGGGAAGGAGAGCGGGGATGG + Intergenic
1175872053 20:62213415-62213437 TGGGGGAAGGAGAGCGGGGATGG + Intergenic
1175872096 20:62213520-62213542 TGGGGGAAGGAGAGCGGGGATGG + Intergenic
1175872124 20:62213587-62213609 TGGGGGAAGGAGAGCGGGGATGG + Intergenic
1175872161 20:62213674-62213696 TGGGGGAAGGAGAGCGGGGATGG + Intergenic
1175872188 20:62213737-62213759 GGGGGGAAGGAGAGTGGGGATGG + Intergenic
1175926989 20:62475874-62475896 TGGGAGGGGCCGGGTGGGGAGGG + Intronic
1175936823 20:62517907-62517929 TGGGGGAGGCTGTGGGGGGATGG - Intergenic
1176025884 20:62985501-62985523 TGGCATAAGATGATTGGGGAGGG - Intergenic
1176080235 20:63268878-63268900 TGGGAGGAGCTGAGCTGGGAGGG + Intronic
1176122019 20:63458257-63458279 GTGGAGAAGCTGGGTGGGAATGG + Intronic
1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1176602928 21:8809384-8809406 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1178207341 21:30485367-30485389 TGGTAGAAGGTGATTGGGTATGG + Intronic
1178362342 21:31958947-31958969 TGTGGAGAGCTGAGTGGGGAGGG - Exonic
1178512337 21:33216047-33216069 TGGAAGGAAATGAGTGGGGAGGG - Intergenic
1178687012 21:34719956-34719978 TGGGGGAGGGTGAGAGGGGAAGG - Intergenic
1178697942 21:34810075-34810097 TGGGAGAGGCCGAGGGGGCATGG + Intronic
1178699079 21:34818429-34818451 TGGGAGAAGCCAAGGGGAGACGG - Intronic
1178897987 21:36576534-36576556 TGGGAAAAGCTGAGAGAGGCAGG - Intronic
1179166942 21:38942843-38942865 TGGGGGAAGCTGTGTGTGGAAGG - Intergenic
1179348230 21:40581560-40581582 TGAGAGGAGGGGAGTGGGGATGG + Intronic
1179582655 21:42353223-42353245 TGGCAGAAGTGGAGTGGAGATGG - Intergenic
1179947420 21:44687629-44687651 TGGGTGAAATTGACTGGGGAAGG + Intronic
1179966261 21:44807862-44807884 TGAGAGCAGCTGAGCAGGGAGGG - Intronic
1180049636 21:45325334-45325356 TGGGGGAAGCTGGGGTGGGAAGG - Intergenic
1180082546 21:45493440-45493462 TGGGTGAGGCTTTGTGGGGAAGG + Intronic
1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180345214 22:11700941-11700963 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180352994 22:11819182-11819204 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180385698 22:12175695-12175717 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180594031 22:16962131-16962153 TGGGAGAGGCAGAGAGGGAAGGG - Exonic
1181481688 22:23203951-23203973 TGGCAGAAGCTGGGCTGGGACGG + Intronic
1181976739 22:26736121-26736143 TGGGAGGAGGTGAGAGGGGATGG - Intergenic
1181976820 22:26736393-26736415 TGGGAGGAGATGAGAGGCGATGG - Intergenic
1182008302 22:26979550-26979572 TGGGAAAATCTGAGTCGGCAGGG + Intergenic
1182090832 22:27593713-27593735 TGGCTGAAGCTGCCTGGGGATGG - Intergenic
1182490092 22:30665928-30665950 AGGGAGGGGCTGGGTGGGGATGG + Intronic
1183210390 22:36447749-36447771 TGAGAGACACTGAGTGGGGAAGG + Intergenic
1183324520 22:37184118-37184140 CTGGGGAAGCTGGGTGGGGAGGG + Intronic
1183696790 22:39428191-39428213 TGGGGGTGGCTCAGTGGGGAAGG - Intronic
1184039829 22:41936213-41936235 GGAGAGAAGCAGAGTGGGGCTGG + Intergenic
1184138358 22:42562539-42562561 TGGAGGACGCAGAGTGGGGAGGG + Intronic
1184155415 22:42663576-42663598 TGGGAGCTGCTGGGTGAGGAAGG + Intergenic
1184320612 22:43739777-43739799 GGGGAGAAGCGGGGTGGGGGTGG - Intronic
1184599116 22:45532249-45532271 TGGGAGGAGCTTTCTGGGGAGGG + Intronic
1185009040 22:48302879-48302901 TGTGGGCTGCTGAGTGGGGAGGG + Intergenic
1185359486 22:50397004-50397026 TGGGGCAAGGAGAGTGGGGAGGG + Intronic
1185380730 22:50506532-50506554 GGGAAGCAGCTGTGTGGGGAGGG - Intronic
1185410025 22:50676960-50676982 TGTGAGAAGCTGGGTGGAGAGGG + Intergenic
949759107 3:7448518-7448540 TGGGAGAGGAGGAGTAGGGATGG + Intronic
949776032 3:7633497-7633519 TGTAAGAAGCCGAGTGGGGCTGG + Intronic
950111250 3:10420135-10420157 TGGCACAGGCTGAGTGGGGGAGG + Intronic
950160892 3:10760221-10760243 TGGGAGAGGCTGCCTGAGGAAGG - Intergenic
950201416 3:11047340-11047362 TGGGAGTGTGTGAGTGGGGACGG - Intergenic
950362119 3:12456859-12456881 TGGGTGAAGCTGAAGGTGGACGG - Intergenic
950399660 3:12760279-12760301 TGGCAGCTGCTGAGCGGGGAGGG - Intronic
950636543 3:14319442-14319464 TGGGAAAAACTGGGTGTGGAGGG + Intergenic
951488434 3:23241080-23241102 TGGGTGAAGCAGATTTGGGAGGG - Intronic
952041392 3:29266210-29266232 TAGGAGAGAGTGAGTGGGGATGG + Intergenic
952235230 3:31472499-31472521 TGGCTGAAGCTGAGTGAGCAAGG - Intergenic
952352294 3:32551961-32551983 TGGGAGAAGCTGAGCCTTGAAGG - Intronic
952540050 3:34358044-34358066 TGGGACAGGGTGGGTGGGGAAGG + Intergenic
952566020 3:34659256-34659278 TGGGAGAATGTGATTTGGGAGGG + Intergenic
952925859 3:38318700-38318722 TGGGGGCAGGGGAGTGGGGAGGG + Intergenic
952934421 3:38384489-38384511 TGGGAGAAGCTGAGAGGTGGGGG + Intronic
953010003 3:39016075-39016097 TGAGAGAAGCAGGGTAGGGAAGG + Intergenic
953114330 3:39976896-39976918 TGGGAGGAGGGGAGTGGGGAGGG + Intronic
953116741 3:40000026-40000048 TGGGAGGAGGGGAGGGGGGAGGG + Intronic
953162001 3:40429557-40429579 TGGGAGTAGCTGAGGCAGGAGGG + Intergenic
953395091 3:42562708-42562730 TGGGAGAAGAGGAATGGAGATGG - Intronic
953637521 3:44675776-44675798 TGGGAGAAGCCGTGTGGGTGTGG + Intergenic
953680365 3:45034416-45034438 TGGAAGTAACTGAGTGGGAATGG + Intronic
953896124 3:46803763-46803785 TGTGTGAAGCTTTGTGGGGATGG - Intronic
953977813 3:47395570-47395592 TGGGAGAAGGTGAGAAGGGGAGG - Intronic
954126949 3:48536932-48536954 TGGGAGGAGGTCACTGGGGAAGG - Intronic
954505459 3:51067525-51067547 AGGGAGAAGGGAAGTGGGGAGGG - Intronic
954513079 3:51145370-51145392 TGGGGTAGGCGGAGTGGGGAGGG - Intronic
954971122 3:54652540-54652562 GGAGAGGAGCTGGGTGGGGAAGG + Intronic
955141893 3:56277876-56277898 TGGGAGAGTCGGAGTGGGGCTGG - Intronic
955281573 3:57599170-57599192 AGGAAGACTCTGAGTGGGGAGGG + Intergenic
955341399 3:58128111-58128133 TGGGTCACGCTGAGAGGGGAAGG + Intronic
959082123 3:101813143-101813165 TGGGATAAGGTCAGTAGGGAGGG - Intronic
959282967 3:104369756-104369778 TGGAAGAAGGTGAGTGGTTAAGG + Intergenic
959590354 3:108073449-108073471 TGGGAGAAGCTGAGGCAGTAAGG + Intronic
959919029 3:111850294-111850316 AGGGAGAAGGTGAGGGGGGCAGG + Intronic
960447210 3:117763190-117763212 AGAGAGAAGCAGAGAGGGGAAGG + Intergenic
960556260 3:119034454-119034476 GGGGCGAAGCTGTTTGGGGACGG - Intronic
960600540 3:119453661-119453683 TGGAAGAAGCATATTGGGGATGG + Intronic
960773591 3:121223397-121223419 TGGTGGAAGCTGAGCTGGGAGGG + Intronic
960898672 3:122532386-122532408 TGGGAGAGGCATTGTGGGGAGGG - Intronic
960985952 3:123281027-123281049 TGGGACTAGCTCAGTGGGGATGG + Intergenic
961882858 3:130075050-130075072 TGGAAGATGCTGAGCTGGGAGGG + Intergenic
961924032 3:130457552-130457574 TAGGAGAAACTGGGTGGGGTAGG - Intronic
962188467 3:133285378-133285400 TGGGGGAAGCGGAGTTGGGAAGG + Intronic
962420083 3:135220207-135220229 AGAGAGCAGCTGAGTGAGGAAGG + Intronic
962489039 3:135873029-135873051 TGGGAGAAGCTGGGAGGTGGTGG - Intergenic
963274846 3:143319726-143319748 GGGGAGAAACTAAGTGGGGAAGG + Intronic
963387143 3:144611738-144611760 AGAGGGAAGCTGAGTGGGGAAGG - Intergenic
963852739 3:150224395-150224417 TGGGAGAACATGAATGGGAATGG + Intergenic
964205575 3:154171281-154171303 GGGTAGAAGCTGTGTGGGGTGGG - Intronic
964310527 3:155386954-155386976 TGGGAAAAGGGAAGTGGGGAGGG + Intronic
964580760 3:158234665-158234687 AGGGAGAAGAGGATTGGGGAGGG - Intronic
964620513 3:158716168-158716190 AGGAAGAAGCTGAGTTGGGAGGG + Intronic
965716935 3:171614821-171614843 TGGGAGAATGTGTGTGCGGAGGG - Intronic
966942184 3:184754264-184754286 TGGGAGAAGGTGATGGGAGAAGG + Intergenic
966942239 3:184754480-184754502 TGGGAGAAGGTGATGGGAGAAGG + Intergenic
966955471 3:184873330-184873352 AGGGAGAAGATGAGTGAGAAGGG + Intronic
967102836 3:186230449-186230471 TGAGAGCAGCTGTGTGGGGAAGG + Intronic
967196541 3:187031196-187031218 TGTTGGAAGCTGAGTGGGCATGG + Intronic
967921196 3:194615783-194615805 GGAGAGTAGGTGAGTGGGGAGGG - Intronic
967977663 3:195044520-195044542 GGGGAGTAGCTGGGTGAGGAGGG - Intergenic
968183192 3:196612458-196612480 TGGGAGTGACTGAGTGGGGAGGG - Intergenic
968215187 3:196883392-196883414 TTATGGAAGCTGAGTGGGGAAGG + Intronic
968612274 4:1562739-1562761 TTCCAGAAGCTGACTGGGGATGG + Intergenic
968746229 4:2362018-2362040 TGGGTTCAGCTGTGTGGGGAGGG - Intronic
969537363 4:7764857-7764879 TTGGAGAGGCTGAGTGAGGTGGG + Intronic
969585292 4:8088030-8088052 TGGGGGGCGCTGAGTGGGGGCGG - Intronic
969728569 4:8940002-8940024 GGAGAGAACCGGAGTGGGGAGGG + Intergenic
969951486 4:10841162-10841184 TGGGAGAAGCAGGATAGGGAAGG + Intergenic
970560001 4:17273317-17273339 TGGGCAGAGCTGGGTGGGGAGGG + Intergenic
971217120 4:24672052-24672074 AGGGCGAAGATGAGTGGAGACGG + Intergenic
971388013 4:26159372-26159394 GAGGAGAAGCTGAGTTGGGGTGG + Intergenic
972242943 4:37213667-37213689 TGGGAGAATGGCAGTGGGGATGG - Intergenic
972353576 4:38259942-38259964 TGGCAGAAGCCTAGAGGGGAGGG + Intergenic
973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973379431 4:49310058-49310080 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973380304 4:49316054-49316076 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973381227 4:49322220-49322242 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973382312 4:49329265-49329287 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973385851 4:49513877-49513899 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
975197414 4:71541735-71541757 TGGGGGGAGCTGAGTGGAAAGGG + Intronic
976674293 4:87687247-87687269 TGGGAGTTGCTGAGTGGAGAAGG - Intergenic
977294128 4:95192598-95192620 GGGGAGAAGGTGAGCAGGGAAGG - Intronic
978529742 4:109701890-109701912 TGGGAGGGGCTGCGTGGGGATGG - Intronic
979488530 4:121297023-121297045 TGGGAGCAGGAGGGTGGGGATGG + Intergenic
981316822 4:143348794-143348816 GGGGAGAGACTGAGTGGAGAAGG - Intronic
981855109 4:149280002-149280024 GGGTAGCAGCTGAGAGGGGAGGG + Intergenic
982890919 4:160849013-160849035 TGTGAAAAGCTGAGTGCTGAAGG - Intergenic
983739762 4:171114886-171114908 AGGGAGAAGCAGAGTGGGAATGG - Intergenic
984617537 4:181915644-181915666 GAGGAGAAGCAGAGAGGGGAGGG + Intergenic
984937052 4:184898549-184898571 TGGGAGAAGCTGAGGGCAGCAGG + Intergenic
985102040 4:186468040-186468062 GGGAAGAAGGAGAGTGGGGAAGG - Intronic
985241644 4:187937101-187937123 TTTGAGAGGCTGAGCGGGGAGGG - Intergenic
985286534 4:188341835-188341857 TAGGAGAAACTGAGTTAGGACGG - Intergenic
986310929 5:6550736-6550758 TGGGAGGAGGTGAGCTGGGAGGG - Intergenic
986648466 5:9941162-9941184 TGGGAGAGGCTGTGTGTGGAGGG - Intergenic
986721319 5:10563513-10563535 AGGGAGCATCTGAGTGGGAACGG - Intergenic
986798840 5:11239444-11239466 TGGGAGAACAGAAGTGGGGAGGG - Intronic
986995295 5:13600997-13601019 TGGGAGCAGCTGAGTAGCCAAGG - Intergenic
987849158 5:23326339-23326361 TGACAGAAGAGGAGTGGGGAGGG + Intergenic
988960546 5:36366802-36366824 TGGTTGAAGCTGGGTGAGGAAGG - Intergenic
989019657 5:36988047-36988069 TAGGGTAAGCTGAGAGGGGAGGG - Intronic
989173209 5:38494120-38494142 TGGGAGAGGGAGACTGGGGAGGG + Intronic
989576203 5:42990938-42990960 TGGGAAATGATGAGTGTGGATGG + Intergenic
991377763 5:65984254-65984276 TGAGAGAAGCTGAGTGGGCAGGG - Intronic
991540310 5:67720479-67720501 AGGGAGAAGAGGAGAGGGGAGGG - Intergenic
992525399 5:77605286-77605308 AGGGAGAAGGTCAGTGGTGAAGG - Intronic
992866827 5:80965235-80965257 TGGGAGATGGAGAGTGTGGATGG + Intronic
993251561 5:85531322-85531344 CTGGAGAGGCTGAGTGGGGGAGG - Intergenic
994639563 5:102389984-102390006 TTGGGGAGGCTGAGTGAGGAGGG - Intronic
996148685 5:120008306-120008328 TAGGAGAACCTCAGTGGGGATGG + Intergenic
996605433 5:125315093-125315115 TTAGATAAACTGAGTGGGGAAGG + Intergenic
996780513 5:127181702-127181724 TCAGAGAAGCTTAGTGGGGAAGG + Intergenic
998042597 5:138961898-138961920 TTGGAGAAGCTAAAAGGGGAAGG - Intronic
998367937 5:141643054-141643076 GGGGAGAAGCTGGGAGGAGAAGG + Exonic
998903563 5:146879661-146879683 TGGGAAAACATGGGTGGGGAGGG - Intronic
999297985 5:150472562-150472584 TGGGAGAAGCTGAGGGAAGCAGG - Intergenic
999498680 5:152125246-152125268 AGGGAGAAGCTAAGTGGTGTGGG - Intergenic
1000062524 5:157669842-157669864 AGGAACAGGCTGAGTGGGGATGG + Intronic
1001049614 5:168403984-168404006 GGGATGAAGCTGGGTGGGGAGGG - Intronic
1001217458 5:169869128-169869150 TGCGAGGAGCTGAGATGGGAAGG - Intronic
1001259867 5:170219237-170219259 TGGGAGGAGATGGGAGGGGAGGG + Intergenic
1001661297 5:173395578-173395600 GGGGAGAAGCTGAGAGGAGGTGG - Intergenic
1002027088 5:176402959-176402981 TGGGAGGAGAGGAGTGGTGAGGG + Intronic
1002051437 5:176573871-176573893 GTGGAGAGGCTGTGTGGGGAGGG + Intronic
1002098605 5:176846363-176846385 TGGGGGGAGCTGAGTAGGGAGGG + Intronic
1003268251 6:4585457-4585479 TGGGAGAAGAAGAGGGGAGAAGG - Intergenic
1003534766 6:6967138-6967160 GGGGAGAAGCTGGGTGTGTAAGG - Intergenic
1004348795 6:14872704-14872726 GGGGAGAAGGGCAGTGGGGAAGG + Intergenic
1004523369 6:16382899-16382921 TGGGAGGGGGGGAGTGGGGAGGG + Intronic
1004734921 6:18395720-18395742 GGGGGGCTGCTGAGTGGGGAAGG + Intronic
1004880542 6:20003085-20003107 TGGGAGAAGTGGAGTGGGGCTGG - Intergenic
1004970754 6:20907676-20907698 TGTGAGGAGCTGAGTGGCGGCGG + Intronic
1005003734 6:21267866-21267888 TGCCAGAAGCTGAGGGGAGAGGG + Intergenic
1005295887 6:24427032-24427054 TGAGAGAAGCTGAGAAGAGAAGG + Intronic
1005352496 6:24949954-24949976 TGGAGGAAGCAGAGCGGGGAAGG + Intronic
1005419127 6:25630996-25631018 TGGGAGAGGTGGAGTGAGGAAGG + Intergenic
1005905514 6:30259591-30259613 GGGGAGAATCTGAGTGCGGGTGG - Intergenic
1006042608 6:31268677-31268699 TGTGAGGAGCCGAGTGTGGACGG - Intergenic
1006400046 6:33812542-33812564 TGGGAGATGCTGAGGGCAGAGGG - Intergenic
1006801948 6:36765291-36765313 GGCGAGAAGGTGAGTGGGGATGG - Intronic
1006911505 6:37566384-37566406 AGAGAGAAGGGGAGTGGGGAGGG + Intergenic
1007072893 6:39049390-39049412 TGGGAGGAGCTGAGAGGGCCAGG + Intronic
1007402394 6:41610821-41610843 TGTGAGAAGCTGGATGGGGGTGG + Intergenic
1007503597 6:42317101-42317123 TGGGAGCTGCTGATTGGTGAAGG - Intronic
1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG + Intergenic
1007813613 6:44504124-44504146 TGGGGGAGCTTGAGTGGGGAGGG + Intergenic
1008402562 6:51080343-51080365 TTTGAGAAGCTGAGGTGGGAGGG + Intergenic
1008491002 6:52087278-52087300 AAGGAGAAGCTGAGAGGGAAGGG - Intronic
1008749008 6:54709261-54709283 GGGGAGAAGAGGAGAGGGGAGGG + Intergenic
1008749015 6:54709281-54709303 GGGGAGAAGAGGAGAGGGGAGGG + Intergenic
1009821932 6:68813697-68813719 TGGGATGAGGGGAGTGGGGAGGG - Intronic
1010484825 6:76397621-76397643 TTGGAGAAGCTGAGTTGAGAGGG + Intergenic
1011217692 6:85022421-85022443 TGGGAGAAGCTGAATCTGGTGGG + Intergenic
1011306043 6:85927980-85928002 TGGGAGTAGGAGAGTGGGGATGG - Intergenic
1013548448 6:111183178-111183200 TGGCAGAAGCAGAGTGGGCAAGG - Intronic
1013778515 6:113704891-113704913 TAGGAAAAGCTGAGTTGAGAGGG + Intergenic
1015484388 6:133752007-133752029 TGCAAGAAGCAGAGTGGGAATGG - Intergenic
1015792404 6:136977004-136977026 AGGAGGAAGCTGAGTGGAGATGG + Intergenic
1017027425 6:150193608-150193630 TGGGAGAAGGGGAGGAGGGAGGG + Intronic
1017250492 6:152274997-152275019 TGGGAGAAGCTGGGAGGAGGTGG - Intronic
1017588354 6:155951450-155951472 TGGGAGAAGGTGATTAGGAAAGG + Intergenic
1017628410 6:156371425-156371447 TAGGAGAAGCCAAGCGGGGAAGG - Intergenic
1017717861 6:157224643-157224665 TTGGAGGGGGTGAGTGGGGAGGG + Intergenic
1018047452 6:159978294-159978316 TGGGGGAATCTGAGTGAGGAAGG - Intronic
1018176682 6:161183721-161183743 TGGGAGAAGAGGGGAGGGGAGGG + Intronic
1018371432 6:163171887-163171909 TGAGAGCAGCTGGGTGGGGAGGG + Intronic
1018614996 6:165678693-165678715 AGGGAGATGCTGAGTGTGGGCGG - Intronic
1018672308 6:166189760-166189782 TTGGAGCAGCTGAGTGAGGGAGG - Intergenic
1019057022 6:169231362-169231384 TGGGAGAAGCAGAGGGAGCACGG + Intronic
1019647642 7:2139551-2139573 TGGGAGAAGCTGCCAGGGGCTGG + Intronic
1020083021 7:5296611-5296633 TGGGCGTGGCTGAGTGGGGGCGG + Intronic
1020083026 7:5296627-5296649 GGGGCGGAGCTGAGTGGGGGCGG + Intronic
1020415551 7:7941905-7941927 TGGGAGAAGCTGACTATGCAGGG - Intronic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1020863728 7:13528709-13528731 TGGGATAGGGTGAGCGGGGAGGG - Intergenic
1021086439 7:16425621-16425643 AGGGAGATGGGGAGTGGGGAGGG - Intergenic
1021311445 7:19102876-19102898 TGGGAGAATAGGAGTGGAGAGGG - Intronic
1021432672 7:20578723-20578745 TGGGAGAAGCTGAATGAGAAAGG - Intergenic
1021601423 7:22367946-22367968 TGGGAAAAGCTGGCTGGGCACGG + Intergenic
1021964438 7:25903884-25903906 TATGAGAAGATGAGTGGGAAGGG - Intergenic
1022400973 7:30037004-30037026 CTAGAGAAGCTGAGTGGGGGAGG + Intronic
1022835538 7:34110298-34110320 TGGGAGAAGCTGAGTGGGGAAGG - Intronic
1023024218 7:36036390-36036412 TGTGGGAGGCTGAGTGGGGGTGG - Intergenic
1024051672 7:45627694-45627716 TTGGGGAAGCTGAGTTGGGCTGG + Intronic
1024849648 7:53696463-53696485 AGGGAGAAGCTGGGAGAGGAGGG + Intergenic
1024919938 7:54545531-54545553 AGGGAGAATTGGAGTGGGGAGGG + Intronic
1025143822 7:56487285-56487307 TTTGGGAGGCTGAGTGGGGAGGG + Intergenic
1025211258 7:57020581-57020603 TGGGCGTGGCTGAGTGGGGGCGG - Intergenic
1025660696 7:63556266-63556288 TGGGCGTGGCTGAGTGGGGGCGG + Intergenic
1026091602 7:67304945-67304967 TGCGAGAAGCTGAGGTGGGAGGG - Intergenic
1026346226 7:69476420-69476442 TGGGAGAAGCTCTAAGGGGAAGG + Intergenic
1026644816 7:72158427-72158449 TTGGAGAGGTGGAGTGGGGAAGG - Intronic
1026877958 7:73890534-73890556 TGGGAGAAGGAGAGAAGGGAGGG - Intergenic
1027169786 7:75863502-75863524 TGAGGGAAGCTGAGAGGGCAGGG - Intronic
1027389835 7:77693958-77693980 TGGCATAAGTTGAGTGTGGAAGG + Intergenic
1027563679 7:79764485-79764507 TGGGAGATGCTAAGTTGGGCTGG - Intergenic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1028223132 7:88219841-88219863 AGGGAGAAGCCGAGGGCGGAAGG + Intronic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1029482798 7:100823355-100823377 TGGGAGAAACTCAGTGTGGCTGG + Intronic
1030384101 7:108847498-108847520 GGGGAGGGGATGAGTGGGGAGGG - Intergenic
1030749013 7:113206421-113206443 TGGGATGAGGGGAGTGGGGAGGG + Intergenic
1032017829 7:128391238-128391260 TGGTTGAAGATGAGAGGGGATGG - Intergenic
1032091630 7:128914417-128914439 TGTGGGAAGCTGAGTGTGGCTGG + Intergenic
1032327976 7:130950203-130950225 TGGGAGAGGCTGAGGAAGGATGG + Intergenic
1032390465 7:131552423-131552445 TGTGGAAAGCTGAGAGGGGAAGG - Intronic
1032416779 7:131741608-131741630 TGGGAGGAGCTGAGGAAGGATGG - Intergenic
1032697054 7:134346258-134346280 TGAGAGAAGCTGTGTCGTGATGG - Intergenic
1033204817 7:139409638-139409660 AGGGAGAAGCTGAGGAGGTATGG + Exonic
1033497811 7:141917313-141917335 TTAGAGAAGCTGAGTGGGAAGGG + Intronic
1033810395 7:145004938-145004960 TGGGAGCAGCCCAGTGGAGAGGG + Intergenic
1033871432 7:145758735-145758757 TGGCTGAAGCTGAGTGAGTAGGG - Intergenic
1034128960 7:148698724-148698746 GGGGAGAAGCTGTTGGGGGAGGG - Intronic
1034162350 7:149002716-149002738 TGGGAGCAGCTGAGTGACGGGGG + Intergenic
1034282515 7:149864039-149864061 TGGGCGAAGCTGGATGTGGAAGG + Intronic
1034359290 7:150480025-150480047 GGGGAGGAGCTGAGTTGGGCAGG + Intergenic
1034435292 7:151060231-151060253 AGGGAGCAGCTGGGTGGGAATGG + Intronic
1035044081 7:155952671-155952693 GGGGAGAAACACAGTGGGGAGGG + Intergenic
1035289085 7:157825784-157825806 TGGTGGAAGCTGAATGGGGCTGG - Intronic
1036223053 8:6936927-6936949 CAGGAGCAGCTGTGTGGGGAGGG + Intronic
1036228288 8:6978662-6978684 CAGGAGCAGCTGTGTGGGGAGGG + Intronic
1036230741 8:6997779-6997801 CAGGAGCAGCTGTGTGGGGAGGG + Intronic
1036233187 8:7016878-7016900 CAGGAGCAGCTGTGTGGGGAGGG + Intronic
1036566000 8:9938493-9938515 AGAGAGTAGCTGTGTGGGGAGGG - Intergenic
1037636311 8:20703823-20703845 TGGGAACAACTGAGTGGGTAGGG - Intergenic
1037781959 8:21875615-21875637 TTTGAGAAGCTGAGGTGGGAGGG - Intergenic
1037891156 8:22624367-22624389 TGGGACAAGCTGGCTGGAGATGG + Intronic
1037927077 8:22851957-22851979 TGGGATCAGCTGTGTGGGGCAGG + Intronic
1037985262 8:23287088-23287110 TGGGAGAAGTGGCTTGGGGATGG - Intronic
1038785985 8:30616722-30616744 TGGAGGAAGCTGTGGGGGGATGG + Intronic
1039596824 8:38797850-38797872 GGGGAGAAGTTTTGTGGGGAGGG + Intronic
1039707444 8:40022165-40022187 TGAGAGAAGCTCTGTGGGCATGG + Intergenic
1039844267 8:41314871-41314893 TGGGTGAATCTGACTAGGGATGG - Intergenic
1039991235 8:42489651-42489673 GGGGAAAATCTGAGTGGGGCTGG - Intronic
1041725140 8:61011156-61011178 TGGGGGAAGCTGAGGCAGGAGGG + Intergenic
1042187931 8:66155458-66155480 TAGTAGAAGCTGTGTGCGGAGGG + Intronic
1043004846 8:74806804-74806826 GAGGAAAAGCTGATTGGGGAAGG - Intronic
1044121418 8:88401192-88401214 TGGGAGAAGCTGAGTGCTACTGG - Intergenic
1045393069 8:101734214-101734236 TGGGAGAGGTTGAGTTGGAAAGG - Intronic
1046526409 8:115387010-115387032 TGGGATAGGGTGAGGGGGGAGGG - Intergenic
1046635403 8:116669900-116669922 TGGTAGAAGCAGAGTGTGTAGGG - Intronic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1047076545 8:121410832-121410854 TGGGGGCAGTGGAGTGGGGATGG - Intergenic
1047253085 8:123195247-123195269 TGGGATAAGCTGGGAGTGGAAGG + Intronic
1047508260 8:125496779-125496801 TGGGAGAAGGAGATTGGGGGTGG + Intergenic
1048163174 8:132039299-132039321 TGAGAGAAGAGGAGTGGGTATGG - Intronic
1048491072 8:134894478-134894500 TGGGAGGTTCTGAGTGAGGAGGG + Intergenic
1049108813 8:140630019-140630041 TGGGAGAAGCAGGGTGTGGGAGG - Intronic
1049265502 8:141665869-141665891 ATGGAGAAGCTGAGTGGAGGAGG + Intergenic
1049713814 8:144080100-144080122 TGGGTGCAGCTGTGTGAGGATGG - Exonic
1049802869 8:144526377-144526399 TGGGGGAGGCTGAGTGGGCCAGG - Exonic
1050242479 9:3651575-3651597 TGGCAGAAGACGAGTGGGCAGGG - Intergenic
1050938469 9:11427622-11427644 TGTGAGAAGCTAAATGGGGATGG + Intergenic
1051250050 9:15150459-15150481 AGGGAGAAGGTGAGTGTGGCTGG + Intergenic
1052389793 9:27866348-27866370 TGGGAGAAGTTGTCTGGGGAAGG + Intergenic
1052637554 9:31123491-31123513 TGCCAGAAGATGGGTGGGGAGGG + Intergenic
1053135614 9:35648800-35648822 TGGGAGAGAGTGAGTGGAGATGG + Intergenic
1053199031 9:36140342-36140364 AGGGAGAAGCTGTGTGGGCCAGG + Intronic
1053341293 9:37336472-37336494 TGGAATAAGCAGAGTTGGGATGG + Intronic
1055677793 9:78682856-78682878 TGGGAGAAGGAGAGAGGGAAGGG - Intergenic
1055892110 9:81134541-81134563 TTGGGGAAGCTGAGGGAGGAGGG - Intergenic
1056262099 9:84859157-84859179 TGGGAGAAGCGGGGTGTGAATGG + Intronic
1056276330 9:84997764-84997786 TGGGAAAACCTGGGTGGGGCTGG + Intronic
1056519766 9:87389438-87389460 TAGGGAAAGCTGAGTGAGGAAGG - Intergenic
1056687467 9:88778333-88778355 TGGGAGAACCCGGCTGGGGAGGG - Intergenic
1056803322 9:89709105-89709127 TAGGAGAGGCTGAGTGGAGAGGG - Intergenic
1056928102 9:90851642-90851664 GGAGAGGAGCTGAGTGGGGAAGG + Intronic
1057010999 9:91601162-91601184 CAGGTGAAGCTGAGTGGGGACGG - Intronic
1057185804 9:93057234-93057256 TGGGTGGAGCTAGGTGGGGATGG - Intergenic
1057298914 9:93865365-93865387 TGGGCAATGGTGAGTGGGGAAGG - Intergenic
1057311591 9:93946450-93946472 TGATAGAAGATGAGTGGGGTGGG - Intergenic
1057554875 9:96080004-96080026 TCAGAGAACCTGAGTTGGGAAGG + Intergenic
1058447175 9:105064482-105064504 TGCCAGAAGCATAGTGGGGAAGG + Intergenic
1058644623 9:107119090-107119112 TGGGTGGAGGTGGGTGGGGATGG + Intergenic
1058876591 9:109250058-109250080 CGGATGAAGCCGAGTGGGGAGGG - Intronic
1059037192 9:110767303-110767325 TGGGAGAATCTGAGTGTGGAAGG + Intronic
1059646880 9:116276711-116276733 GGAGAGAAGAGGAGTGGGGAGGG - Intronic
1059734980 9:117091679-117091701 GGGGAGAGGTGGAGTGGGGAGGG + Intronic
1060024788 9:120161917-120161939 TGGGAGGAGGTGGGAGGGGAGGG + Intergenic
1060185627 9:121562393-121562415 TGGGAGAGGCTGTGTAGAGAGGG - Intergenic
1060402164 9:123355550-123355572 TGGGAGGAGCTGTGTGTGGTCGG + Intergenic
1060843616 9:126816694-126816716 TGGGATTAGTTGAGTGGGGCTGG + Intronic
1060912733 9:127363612-127363634 TGGGAGGAGCACAGTGTGGACGG + Intronic
1061275567 9:129568098-129568120 TTGGAGAGGAAGAGTGGGGAGGG - Intergenic
1061482812 9:130905435-130905457 TGGGAGAAGCTGAGGGGCGTAGG + Intronic
1061697986 9:132392290-132392312 TGGGGAAAGCTGAATGGGGCAGG + Intronic
1061755152 9:132807178-132807200 TGGGAGATGCTGGGGGGGGCGGG + Intronic
1061789176 9:133049852-133049874 CGGGGGAGGCTGAGTGGGGGTGG - Intronic
1061957247 9:133970080-133970102 TGGGAGCTGTTGAGTGGGCAGGG - Intronic
1062056729 9:134472751-134472773 TGGGAAAAACTGAGAGTGGAGGG - Intergenic
1062248381 9:135581917-135581939 TGGGTGAAGCACAGTGGAGATGG + Intergenic
1062305418 9:135903896-135903918 TGTAAGAGACTGAGTGGGGAGGG - Intronic
1062465659 9:136679889-136679911 TGGAAGATTCTGAGAGGGGAGGG - Intronic
1062558347 9:137127443-137127465 TGGGAAAAGCTGAGTGGGGGAGG - Intergenic
1062672768 9:137721349-137721371 TGGGAGGGGGTGAGAGGGGAGGG - Intronic
1062672823 9:137721537-137721559 TGGGAGAAGGTGAGAGGCGTGGG - Intronic
1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203356585 Un_KI270442v1:154518-154540 TGGGATGGGGTGAGTGGGGAGGG + Intergenic
1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203549457 Un_KI270743v1:155639-155661 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203550415 Un_KI270743v1:161951-161973 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1185596179 X:1308358-1308380 TGGAAGAAGGTGAGAGGGGGAGG + Intronic
1186654503 X:11598237-11598259 TGGAAGAGGATGAGTGGGGATGG + Intronic
1187132052 X:16512543-16512565 TGGGAGTGGCTAAGTGGGGGAGG - Intergenic
1187212035 X:17241363-17241385 TGGGAGAAGCGAAGTAGAGAAGG - Intergenic
1187711377 X:22057890-22057912 TGGGGGCAGCTGACTGGGTAGGG + Intronic
1188030520 X:25258481-25258503 TGGCAGAAGCTAAGAGGGAAGGG + Intergenic
1188137311 X:26505225-26505247 TGGAAGAAGCAGAGTGGGTGGGG - Intergenic
1189129696 X:38485398-38485420 GGGGAGAGGCAGATTGGGGAAGG + Intronic
1189129707 X:38485422-38485444 GGGGAGAGGCGGGGTGGGGAAGG + Intronic
1189129719 X:38485446-38485468 GGGGAGAGGCGGGGTGGGGAGGG + Intronic
1189129731 X:38485470-38485492 GGGGAGAGGCGGGGTGGGGAGGG + Intronic
1189129753 X:38485518-38485540 GGGGAAAAGCCGGGTGGGGAGGG + Intronic
1189272546 X:39761418-39761440 TCTGAGAAGCTCAGTGGGGTTGG - Intergenic
1189290544 X:39882331-39882353 AGGATGAAGCAGAGTGGGGAGGG + Intergenic
1189346853 X:40248337-40248359 GGAGAGAAGCAGAGTGGGGGTGG - Intergenic
1189757062 X:44282793-44282815 TGGAAGAAACTGAGGGTGGAGGG + Intronic
1189908202 X:45783388-45783410 GGACAGAAGCTGAGTTGGGATGG - Intergenic
1189985536 X:46550324-46550346 TGGGTACAACTGAGTGGGGATGG - Intergenic
1190120244 X:47653084-47653106 TGTTAGAAATTGAGTGGGGAGGG + Intronic
1190241683 X:48661537-48661559 TGGGAAAAGATGAGGGGGAACGG - Intergenic
1190829073 X:54044291-54044313 TGGGAGAAGCCCAGTGGCGGTGG + Intronic
1191613022 X:63136870-63136892 TGCCTGAAGCAGAGTGGGGAAGG - Intergenic
1191623275 X:63242056-63242078 TGCCTGAAGCAGAGTGGGGAAGG + Intergenic
1192174897 X:68879397-68879419 TGTGACAAGCTGTGAGGGGAGGG - Intergenic
1192288725 X:69767363-69767385 TAGGAGGAGGTGAGTAGGGAAGG - Intronic
1192370042 X:70505636-70505658 TGGGAGGAGCCTAGAGGGGAGGG + Intergenic
1193013201 X:76701546-76701568 TGGGAGAGGTTGAGTAGGGTTGG - Intergenic
1197287019 X:124607608-124607630 TGGGAGAAGCAGATTGGGTAGGG + Intronic
1197467182 X:126819634-126819656 AGGGAGAAAAGGAGTGGGGAGGG - Intergenic
1197886092 X:131219983-131220005 TGGGAGAAGGGGAATGGTGAGGG + Intergenic
1198062581 X:133061957-133061979 TGGGACCTGCTGAGTGGGGAGGG - Intronic
1198131976 X:133704730-133704752 TGGGAGAAGGGGTGAGGGGAAGG + Intronic
1198166788 X:134065428-134065450 TTGGAGAGGCAGTGTGGGGAGGG - Intergenic
1198683953 X:139208231-139208253 TGGGAAAGGCTGGGTGGGAAAGG - Intronic
1199100216 X:143790729-143790751 TGGGAGCAACTAAGTGGGGCTGG - Intergenic
1199404200 X:147436820-147436842 TGGGAAAAGCTGGGTGAAGAAGG + Intergenic
1199791288 X:151157513-151157535 TTGGAGAAGCAGTGTGGGGCAGG + Intergenic
1200016142 X:153165038-153165060 GGAGAGAAGGAGAGTGGGGAGGG + Intergenic
1200253058 X:154564045-154564067 CGGGAGGAGGTGGGTGGGGAGGG + Intronic
1200264709 X:154640370-154640392 CGGGAGGAGGTGGGTGGGGAGGG - Intergenic
1201895445 Y:18987483-18987505 TGTGGGAAGCTGAGAAGGGAGGG - Intergenic