ID: 1022837493

View in Genome Browser
Species Human (GRCh38)
Location 7:34131624-34131646
Sequence AAGTGAAGGCCTCTAGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022837493 Original CRISPR AAGTGAAGGCCTCTAGCATC TGG (reversed) Intronic
900688800 1:3966869-3966891 AAGTGGAGGCCTCTCCCATGTGG + Intergenic
902176375 1:14653943-14653965 AAGGGAATGCCACTGGCATCTGG - Intronic
904018814 1:27445607-27445629 AAGTGAAGCCCCTGAGCATCTGG - Intronic
909686103 1:78350831-78350853 ATGTGATGGCCTCTAGAAGCTGG - Intronic
910756776 1:90702357-90702379 AAGTAGAGGGCTCTAGCTTCTGG - Intergenic
917072541 1:171168433-171168455 AAATGAGGCCCTCTACCATCTGG + Intergenic
919944744 1:202310912-202310934 CAGTGAAGGTCTCTTGCACCTGG - Intronic
923499136 1:234550197-234550219 AAGTGAAAGCATGTAGCATCAGG + Intergenic
1063516028 10:6696372-6696394 AAGTGGAGGCCTCTACCTTGGGG + Intergenic
1063800378 10:9570508-9570530 AAGAGCAGGCAGCTAGCATCTGG - Intergenic
1078357260 11:10641748-10641770 AAGTGAAGGCCATGAGCATGGGG + Intronic
1078860573 11:15242892-15242914 AAGTGCAGGCCTCTAGAATCAGG - Intronic
1079499128 11:21082632-21082654 ATTTGAAAGCCTCTAGGATCTGG + Intronic
1080119452 11:28660401-28660423 AAGTGAGAGCCTCTAGATTCTGG + Intergenic
1083427200 11:62594355-62594377 AATGGAAGGCCTCTGGCTTCAGG - Exonic
1083707322 11:64525484-64525506 GAGGGGAGGCCTCCAGCATCTGG - Intergenic
1086603606 11:88666300-88666322 AAGGGCATGCCTCTAGCTTCTGG + Intronic
1089589598 11:119531928-119531950 ACGCGAAGGCCTCAACCATCTGG + Intergenic
1090332091 11:125940252-125940274 AAGGGAAGGCCTCTAACTGCTGG + Intergenic
1091231221 11:133989067-133989089 AAGTGCAGGCCTCTAGGACAGGG + Intergenic
1092043643 12:5408153-5408175 AAGTGACGGTCTCTAGGGTCTGG - Intergenic
1093687668 12:22075879-22075901 ACCTTAAAGCCTCTAGCATCAGG + Intronic
1097274036 12:57799379-57799401 ATGTGAAGGCCTATACAATCTGG - Intronic
1098857289 12:75667167-75667189 ATGAGAAGGCCTCTTTCATCTGG - Intergenic
1105878963 13:24586737-24586759 AAGTGAAGAATTCTAGCATCAGG + Intergenic
1105920875 13:24962313-24962335 AAGTGAAGAATTCTAGCATCAGG - Intergenic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1108327475 13:49348132-49348154 AACACAAGGCCTCTAGCGTCCGG - Intronic
1112149158 13:96737812-96737834 AAGTGAAGGCCTCTAGAACCTGG - Intronic
1112149756 13:96745417-96745439 AAGTGATGACCTCTCTCATCTGG + Intronic
1116396348 14:44452038-44452060 AAGTCCAGGCCTCTGGCCTCTGG - Intergenic
1119364150 14:74077452-74077474 AAGGGAATGGCTCTAGCTTCTGG + Intronic
1120939939 14:89938108-89938130 AAATGAAGGAGTCTAGCATCTGG + Intronic
1123123128 14:105927235-105927257 CAGTGAAGGCCTCCAGAGTCTGG - Intronic
1126446634 15:48753446-48753468 AAATCAAGGCTTCTAGAATCAGG - Intronic
1129181010 15:73875539-73875561 AAGCCAAGGCCTCTAGCAGCAGG + Intronic
1129560460 15:76560974-76560996 AACTGAAGACAGCTAGCATCAGG + Intronic
1134491483 16:14699049-14699071 AAGAAAAGGCCTCAGGCATCTGG - Intergenic
1134496864 16:14738167-14738189 AAGAAAAGGCCTCAGGCATCTGG - Intronic
1144671172 17:17133452-17133474 ATGAGAATGCCTTTAGCATCAGG - Intronic
1152139857 17:78529936-78529958 TAGTGAAGGCCTCTGGGATGTGG - Intronic
1155512755 18:26594016-26594038 AAGTGAAGGCATCAAGGATGGGG - Intronic
1155663251 18:28276983-28277005 AACTGGAGGCCTCTAGTAGCTGG + Intergenic
1157286255 18:46379403-46379425 AAGTAGAGGCCTTTAGAATCTGG - Intronic
1157539338 18:48488552-48488574 GAGGGGAGGCCTCTAGCCTCAGG + Intergenic
1157685770 18:49641115-49641137 AACTGAAGGCCCCCAGCTTCAGG + Intergenic
1158691531 18:59665648-59665670 AAGTAAAAGCCTCTAACATCAGG + Intronic
1160835524 19:1122905-1122927 AGGTGATGGCCTCTAGCTGCAGG + Exonic
1165718939 19:38064956-38064978 CAGGGAAGACCTCCAGCATCTGG + Intronic
927684953 2:25164047-25164069 ATGTGAAGGCCCTTTGCATCAGG - Intronic
931790993 2:65664133-65664155 AAGTAGAGGCCTCCAGCATCAGG - Intergenic
931943489 2:67279261-67279283 AAGAGATGGCCTGTAGCCTCAGG - Intergenic
936787793 2:116115423-116115445 AATTCAAGTCCTCTACCATCTGG + Intergenic
937289412 2:120773258-120773280 GAGCGTAGGCCTGTAGCATCCGG + Intronic
938708180 2:133952069-133952091 AAGTGATGGGGTCCAGCATCTGG - Intergenic
940605922 2:155924349-155924371 CAGTGGAGGCCTCTAGGATTTGG - Intergenic
942919306 2:181351920-181351942 AAGTGGAGGCCTCTCTGATCTGG - Intergenic
945072977 2:206009576-206009598 CAGTGGAGGCCTCTCACATCCGG - Exonic
946308609 2:218870724-218870746 AGGTGAAGGCAGCTGGCATCAGG - Intronic
1170541832 20:17396881-17396903 CAGTGAAGGCCTCTAGGAAATGG + Intronic
1170858069 20:20076018-20076040 AATTGAAGGTCTCTACCATCAGG + Intronic
1174610308 20:51792815-51792837 ATGTGAAGGACCCCAGCATCTGG - Intronic
1175190074 20:57205794-57205816 CAGTGCTGGCCTGTAGCATCTGG - Intronic
1179097055 21:38325327-38325349 ATGTGAAGTCCTCTAGCCTAGGG + Intergenic
1182638507 22:31748763-31748785 AAGTGCTGGCGTCTGGCATCAGG + Intronic
1183189790 22:36314454-36314476 AAGGGAAGGCCAGGAGCATCCGG - Intronic
1183562783 22:38589519-38589541 AATTGAAGGACTCTACCCTCTGG + Intronic
950366226 3:12486172-12486194 CAGTGAGTGCCTCTGGCATCTGG + Intronic
962351897 3:134662516-134662538 TTGTGAAGGCATCTAGCATAGGG - Intronic
964235644 3:154523897-154523919 AAGTGAAGGCAACAAGCAGCAGG - Intergenic
966902193 3:184494543-184494565 AAGTCAGGGACCCTAGCATCTGG + Intronic
967695550 3:192527225-192527247 CAGGGAAGGCTGCTAGCATCTGG - Intronic
978220986 4:106273957-106273979 ACTTGAAAGCCTCTAGCTTCAGG - Intronic
986037039 5:3950494-3950516 AAGTGGAGGCCTCTAGGATTTGG - Intergenic
986253894 5:6085692-6085714 AGGTAAAGGCCTCAGGCATCTGG + Intergenic
988228761 5:28448065-28448087 CAGTGGAGGCCTCTAGGATTTGG + Intergenic
989370508 5:40702045-40702067 AAGGAAAGACCTCTAGCAGCTGG + Intergenic
994668460 5:102736578-102736600 AAGTGAAGGGCATTAACATCAGG - Intergenic
994805496 5:104442319-104442341 AAGTAAAGACCTCAAGCAACTGG - Intergenic
995447638 5:112263645-112263667 AAATGAAGGACTCTACAATCAGG + Intronic
1000918834 5:167114983-167115005 AAGTAAAGGGCATTAGCATCAGG + Intergenic
1001485614 5:172117562-172117584 AGTTGAGGGCTTCTAGCATCTGG + Exonic
1002062094 5:176631131-176631153 CAGGGAAGGCCTCTACCAGCAGG + Intronic
1005659316 6:27978638-27978660 AAGGGATGTCCTCTAGAATCTGG + Intergenic
1009820728 6:68797645-68797667 AACTGAAGGCTTCCAGCTTCTGG + Intronic
1009823627 6:68838156-68838178 AAGAGAAAGCCTCCAGCAACTGG - Intronic
1021280615 7:18712339-18712361 AAGGGATGGGCTCTAGCATGTGG + Intronic
1022837493 7:34131624-34131646 AAGTGAAGGCCTCTAGCATCTGG - Intronic
1023521707 7:41056185-41056207 TAGTGAATGCCTTGAGCATCTGG + Intergenic
1023913571 7:44572004-44572026 AAGGGAAGGCCTACAGCAACAGG + Intronic
1024272098 7:47650396-47650418 AAATGAGGGACTCTAGCCTCAGG - Intergenic
1026403148 7:70036730-70036752 AAGAGAAGGCCTCTGCCAGCAGG + Intronic
1027664614 7:81029663-81029685 AAGTGAAAGCCTGAAGCAGCTGG - Intergenic
1036126677 8:6069355-6069377 AAGTGAAGGCGCCAAGCATCAGG - Intergenic
1042917818 8:73892599-73892621 AAGGGAAGGGCTCTAGCGACAGG + Intergenic
1048273370 8:133046863-133046885 TGGTGAAGGGCTCTAGCACCAGG + Intronic
1049835744 8:144734438-144734460 AGGTGGAGGCCTCCAGCGTCCGG - Intronic
1049920826 9:362546-362568 GAGTGAAGGCCCCTATCAGCTGG - Intronic
1051646145 9:19270394-19270416 AAGCTAGGGCCTCTAGCCTCTGG + Intronic
1053387537 9:37706358-37706380 AAGTGAGGGCCTATTGCATTAGG + Intronic
1055215764 9:73860155-73860177 AAGTTCAGCCCTCTAGCAACTGG - Intergenic
1057765078 9:97909431-97909453 AAGTGTATGCCTCTAGCAGTGGG + Intronic
1186144827 X:6614356-6614378 AAGTGAAAAACTCTAGCAACAGG + Intergenic
1187408853 X:19029525-19029547 AAGTGAAGGTTTCTAGTTTCTGG + Intronic
1188945728 X:36299010-36299032 AAGTGAAGACCTCTATCTTTTGG - Exonic
1190473510 X:50806116-50806138 AAATGTAGGCCTCAAGCAACTGG + Intronic
1192432992 X:71125248-71125270 AAGGGAAGGGCTTTAGCATGTGG + Intronic
1195273762 X:103258190-103258212 AGGTGAAGGCCTGTATCACCTGG - Intergenic
1195926719 X:110033546-110033568 TAGCAAAGGCATCTAGCATCTGG + Intronic
1197386781 X:125812307-125812329 CAGTGAAGGCCTCTAGGATTTGG - Intergenic
1199859565 X:151789239-151789261 AAGGGAAGGCCTCCAGGAACTGG + Intergenic
1200175738 X:154115048-154115070 AAGTGAACACCTCTAGAATCTGG - Intergenic