ID: 1022839730

View in Genome Browser
Species Human (GRCh38)
Location 7:34151716-34151738
Sequence TTTAGTTAACAGTTGAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022839727_1022839730 -9 Left 1022839727 7:34151702-34151724 CCTAGAGTCAATGGTTTAGTTAA 0: 1
1: 0
2: 0
3: 11
4: 189
Right 1022839730 7:34151716-34151738 TTTAGTTAACAGTTGAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022839730 Original CRISPR TTTAGTTAACAGTTGAGGCA GGG Intronic
No off target data available for this crispr