ID: 1022842166

View in Genome Browser
Species Human (GRCh38)
Location 7:34175151-34175173
Sequence CGGCAGCGAGGCTGGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7063
Summary {0: 1015, 1: 2056, 2: 1763, 3: 968, 4: 1261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022842166_1022842177 30 Left 1022842166 7:34175151-34175173 CCCCTCCCCCAGCCTCGCTGCCG 0: 1015
1: 2056
2: 1763
3: 968
4: 1261
Right 1022842177 7:34175204-34175226 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954
1022842166_1022842176 29 Left 1022842166 7:34175151-34175173 CCCCTCCCCCAGCCTCGCTGCCG 0: 1015
1: 2056
2: 1763
3: 968
4: 1261
Right 1022842176 7:34175203-34175225 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022842166 Original CRISPR CGGCAGCGAGGCTGGGGGAG GGG (reversed) Intergenic
Too many off-targets to display for this crispr