ID: 1022842167

View in Genome Browser
Species Human (GRCh38)
Location 7:34175152-34175174
Sequence GCGGCAGCGAGGCTGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7146
Summary {0: 1025, 1: 2065, 2: 1803, 3: 995, 4: 1258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022842167_1022842176 28 Left 1022842167 7:34175152-34175174 CCCTCCCCCAGCCTCGCTGCCGC 0: 1025
1: 2065
2: 1803
3: 995
4: 1258
Right 1022842176 7:34175203-34175225 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978
1022842167_1022842177 29 Left 1022842167 7:34175152-34175174 CCCTCCCCCAGCCTCGCTGCCGC 0: 1025
1: 2065
2: 1803
3: 995
4: 1258
Right 1022842177 7:34175204-34175226 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022842167 Original CRISPR GCGGCAGCGAGGCTGGGGGA GGG (reversed) Intergenic
Too many off-targets to display for this crispr