ID: 1022842168

View in Genome Browser
Species Human (GRCh38)
Location 7:34175153-34175175
Sequence GGCGGCAGCGAGGCTGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7411
Summary {0: 985, 1: 2028, 2: 1771, 3: 1042, 4: 1585}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022842168_1022842177 28 Left 1022842168 7:34175153-34175175 CCTCCCCCAGCCTCGCTGCCGCC 0: 985
1: 2028
2: 1771
3: 1042
4: 1585
Right 1022842177 7:34175204-34175226 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954
1022842168_1022842176 27 Left 1022842168 7:34175153-34175175 CCTCCCCCAGCCTCGCTGCCGCC 0: 985
1: 2028
2: 1771
3: 1042
4: 1585
Right 1022842176 7:34175203-34175225 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022842168 Original CRISPR GGCGGCAGCGAGGCTGGGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr