ID: 1022842169

View in Genome Browser
Species Human (GRCh38)
Location 7:34175156-34175178
Sequence CAAGGCGGCAGCGAGGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6243
Summary {0: 1037, 1: 2094, 2: 1697, 3: 760, 4: 655}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022842169_1022842176 24 Left 1022842169 7:34175156-34175178 CCCCCAGCCTCGCTGCCGCCTTG 0: 1037
1: 2094
2: 1697
3: 760
4: 655
Right 1022842176 7:34175203-34175225 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978
1022842169_1022842177 25 Left 1022842169 7:34175156-34175178 CCCCCAGCCTCGCTGCCGCCTTG 0: 1037
1: 2094
2: 1697
3: 760
4: 655
Right 1022842177 7:34175204-34175226 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022842169 Original CRISPR CAAGGCGGCAGCGAGGCTGG GGG (reversed) Intergenic
Too many off-targets to display for this crispr