ID: 1022842170

View in Genome Browser
Species Human (GRCh38)
Location 7:34175157-34175179
Sequence GCAAGGCGGCAGCGAGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6328
Summary {0: 1061, 1: 2132, 2: 1737, 3: 742, 4: 656}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022842170_1022842177 24 Left 1022842170 7:34175157-34175179 CCCCAGCCTCGCTGCCGCCTTGC 0: 1061
1: 2132
2: 1737
3: 742
4: 656
Right 1022842177 7:34175204-34175226 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954
1022842170_1022842176 23 Left 1022842170 7:34175157-34175179 CCCCAGCCTCGCTGCCGCCTTGC 0: 1061
1: 2132
2: 1737
3: 742
4: 656
Right 1022842176 7:34175203-34175225 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978
1022842170_1022842178 30 Left 1022842170 7:34175157-34175179 CCCCAGCCTCGCTGCCGCCTTGC 0: 1061
1: 2132
2: 1737
3: 742
4: 656
Right 1022842178 7:34175210-34175232 CAGCGAGACACCGTGGGCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022842170 Original CRISPR GCAAGGCGGCAGCGAGGCTG GGG (reversed) Intergenic
Too many off-targets to display for this crispr