ID: 1022842171 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:34175158-34175180 |
| Sequence | TGCAAGGCGGCAGCGAGGCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 6159 | |||
| Summary | {0: 1085, 1: 2164, 2: 1733, 3: 667, 4: 510} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1022842171_1022842176 | 22 | Left | 1022842171 | 7:34175158-34175180 | CCCAGCCTCGCTGCCGCCTTGCA | 0: 1085 1: 2164 2: 1733 3: 667 4: 510 |
||
| Right | 1022842176 | 7:34175203-34175225 | TAGCAATCAGCGAGACACCGTGG | 0: 5 1: 920 2: 1493 3: 979 4: 978 |
||||
| 1022842171_1022842177 | 23 | Left | 1022842171 | 7:34175158-34175180 | CCCAGCCTCGCTGCCGCCTTGCA | 0: 1085 1: 2164 2: 1733 3: 667 4: 510 |
||
| Right | 1022842177 | 7:34175204-34175226 | AGCAATCAGCGAGACACCGTGGG | 0: 5 1: 909 2: 1484 3: 974 4: 954 |
||||
| 1022842171_1022842178 | 29 | Left | 1022842171 | 7:34175158-34175180 | CCCAGCCTCGCTGCCGCCTTGCA | 0: 1085 1: 2164 2: 1733 3: 667 4: 510 |
||
| Right | 1022842178 | 7:34175210-34175232 | CAGCGAGACACCGTGGGCGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1022842171 | Original CRISPR | TGCAAGGCGGCAGCGAGGCT GGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||