ID: 1022842172

View in Genome Browser
Species Human (GRCh38)
Location 7:34175159-34175181
Sequence CTGCAAGGCGGCAGCGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6148
Summary {0: 1065, 1: 2097, 2: 1670, 3: 692, 4: 624}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022842172_1022842177 22 Left 1022842172 7:34175159-34175181 CCAGCCTCGCTGCCGCCTTGCAG 0: 1065
1: 2097
2: 1670
3: 692
4: 624
Right 1022842177 7:34175204-34175226 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954
1022842172_1022842178 28 Left 1022842172 7:34175159-34175181 CCAGCCTCGCTGCCGCCTTGCAG 0: 1065
1: 2097
2: 1670
3: 692
4: 624
Right 1022842178 7:34175210-34175232 CAGCGAGACACCGTGGGCGTAGG No data
1022842172_1022842176 21 Left 1022842172 7:34175159-34175181 CCAGCCTCGCTGCCGCCTTGCAG 0: 1065
1: 2097
2: 1670
3: 692
4: 624
Right 1022842176 7:34175203-34175225 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022842172 Original CRISPR CTGCAAGGCGGCAGCGAGGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr