ID: 1022842173

View in Genome Browser
Species Human (GRCh38)
Location 7:34175163-34175185
Sequence CACACTGCAAGGCGGCAGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5706
Summary {0: 5, 1: 1087, 2: 2036, 3: 1634, 4: 944}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022842173_1022842177 18 Left 1022842173 7:34175163-34175185 CCTCGCTGCCGCCTTGCAGTGTG 0: 5
1: 1087
2: 2036
3: 1634
4: 944
Right 1022842177 7:34175204-34175226 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954
1022842173_1022842176 17 Left 1022842173 7:34175163-34175185 CCTCGCTGCCGCCTTGCAGTGTG 0: 5
1: 1087
2: 2036
3: 1634
4: 944
Right 1022842176 7:34175203-34175225 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978
1022842173_1022842178 24 Left 1022842173 7:34175163-34175185 CCTCGCTGCCGCCTTGCAGTGTG 0: 5
1: 1087
2: 2036
3: 1634
4: 944
Right 1022842178 7:34175210-34175232 CAGCGAGACACCGTGGGCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022842173 Original CRISPR CACACTGCAAGGCGGCAGCG AGG (reversed) Intergenic
Too many off-targets to display for this crispr