ID: 1022842174

View in Genome Browser
Species Human (GRCh38)
Location 7:34175171-34175193
Sequence TCTGAGATCACACTGCAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4881
Summary {0: 8, 1: 2877, 2: 1001, 3: 473, 4: 522}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022842174_1022842176 9 Left 1022842174 7:34175171-34175193 CCGCCTTGCAGTGTGATCTCAGA 0: 8
1: 2877
2: 1001
3: 473
4: 522
Right 1022842176 7:34175203-34175225 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978
1022842174_1022842177 10 Left 1022842174 7:34175171-34175193 CCGCCTTGCAGTGTGATCTCAGA 0: 8
1: 2877
2: 1001
3: 473
4: 522
Right 1022842177 7:34175204-34175226 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954
1022842174_1022842178 16 Left 1022842174 7:34175171-34175193 CCGCCTTGCAGTGTGATCTCAGA 0: 8
1: 2877
2: 1001
3: 473
4: 522
Right 1022842178 7:34175210-34175232 CAGCGAGACACCGTGGGCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022842174 Original CRISPR TCTGAGATCACACTGCAAGG CGG (reversed) Intergenic
Too many off-targets to display for this crispr