ID: 1022842175

View in Genome Browser
Species Human (GRCh38)
Location 7:34175174-34175196
Sequence CAGTCTGAGATCACACTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6610
Summary {0: 10, 1: 3679, 2: 1433, 3: 764, 4: 724}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022842175_1022842180 28 Left 1022842175 7:34175174-34175196 CCTTGCAGTGTGATCTCAGACTG 0: 10
1: 3679
2: 1433
3: 764
4: 724
Right 1022842180 7:34175225-34175247 GGCGTAGGACCCTCTGAGCCAGG 0: 522
1: 1421
2: 1460
3: 1026
4: 831
1022842175_1022842178 13 Left 1022842175 7:34175174-34175196 CCTTGCAGTGTGATCTCAGACTG 0: 10
1: 3679
2: 1433
3: 764
4: 724
Right 1022842178 7:34175210-34175232 CAGCGAGACACCGTGGGCGTAGG No data
1022842175_1022842176 6 Left 1022842175 7:34175174-34175196 CCTTGCAGTGTGATCTCAGACTG 0: 10
1: 3679
2: 1433
3: 764
4: 724
Right 1022842176 7:34175203-34175225 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978
1022842175_1022842177 7 Left 1022842175 7:34175174-34175196 CCTTGCAGTGTGATCTCAGACTG 0: 10
1: 3679
2: 1433
3: 764
4: 724
Right 1022842177 7:34175204-34175226 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022842175 Original CRISPR CAGTCTGAGATCACACTGCA AGG (reversed) Intergenic
Too many off-targets to display for this crispr